We narrowed to 3,140 results for: GAI
-
Plasmid#163331PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the CAG promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pMX-hFTH1-CD90.2-Rluc_miR
Plasmid#163330PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhFTH1Available SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Rluc_miR
Plasmid#163329PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-SZ158a-sfGFP
Plasmid#162446PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptorsDepositorInsertC-X-C chemokine receptor type 4 (CXCR4 Human)
UseTagssfGFPExpressionMammalianMutationtruncation from aa52 to aa257PromoterCMVAvailable SinceAvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2-RNA-MUT (nonsense mutation of sgYTHDF2-1)
Plasmid#232948PurposeExpresses the RNA-binding-deficient mutant of YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-RNA-MUT (YTHDF2 Human)
UseLentiviralTagsExpressionMutationRNA binding mutation (K416A+R527A), synonymous mu…PromoterAvailable SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PCTK1
Plasmid#23754DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PCTK1
Plasmid#20560DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
BAP1-wt (siRNA resistant)
Plasmid#108439PurposeStable expression of BAP1-wt in mammalian cells, gene has an introduced siRNA-resistance against siBAP1.DepositorInsertBAP1 (BAP1 Human)
UseTagsExpressionMammalianMutationc.1641C>T, c.1644T>A, c.1647T>C, c.1650C…PromoterCMVAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
BAP1-C91A (siRNA resistant)
Plasmid#108438PurposeStable expression of BAP1-C91A (catalytically inactive mutant) in mammalian cells, gene has an introduced siRNA-resistance against siBAP1.DepositorInsertBAP1 (BAP1 Human)
UseTagsExpressionMammalianMutationC91A: c.271T>G, c.272G>C; others: c.1641C&g…PromoterCMVAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide1
Plasmid#118166PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide2
Plasmid#118167PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA2 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 BFP-guide1
Plasmid#118165PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the BFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide3
Plasmid#118168PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA3 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide1
Plasmid#118162PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA1 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118163PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118164PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118161PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only