We narrowed to 13,309 results for: sequence
-
Plasmid#111502PurposeExpresses a zinc finger specific to the human VEGFA locus, which is linked to a VPR transcriptional activation domain via a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].DepositorInsertZF(VEGFA)-StaPL(AI)-YFP-VPR
ExpressionMammalianMutationThe HCV NS3 protease carries V36M, T54A, and S122…PromoterCMVAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cntn1-Fc-His
Plasmid#72065PurposeExpresses the extracellular region of the Contactin 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-2X-P2A-Puro
Plasmid#110840PurposeLentiviral vector for constitutive expression of 2X in mammalian cells (codon optimized)DepositorInsertBE3RA-2X
UseLentiviralMutationD10A and 2 tandem NLS sequences in the XTEN linkerPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish ArcLight Q175
Plasmid#53616PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertZebrafish ArcLight-Q175 (tpte Synthetic, Aequorea victoria, Zebrafish)
ExpressionMammalianMutationDr-VSD contains R153Q mutation and an amino acid …PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-short_BrokenHeart (no BC)
Plasmid#86950PurposeAAV transfer plasmid containing the BrokenHeart construct: a hyperpiggybac donor transposon interrupting the tdTomato fluorophore. Transposase activity rescues coding sequence.DepositorInsertBrokenheart construct
UseAAVExpressionMammalianAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorInsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
L1cam-Fc-His
Plasmid#72083PurposeExpresses the extracellular region of the L1CAM protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF
Plasmid#100280PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only