We narrowed to 14,200 results for: cas9
-
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pICSL90016
Plasmid#117514PurposeCas9_2 Golden Gate Level 0DepositorInsertBsaI:AATG:Cas9_2:GCTT:BsaI
UseCRISPRTagsNLS_SV40ExpressionPlantAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRGE31
Plasmid#50929PurposeExpressing sgRNA and Cas9 in plants. The sgRNA was controlled by rice snoRNA U3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRice snoRNA U3 and dual 35S promoterAvailable sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6c-V106W
Plasmid#215826PurposeExpress CBE6c V106W (with SpCas9) in mammalian cellsDepositorInsertCBE6c V106W-SpCas9-2xUGI (cas9 )
UseIn vitro transcription templateAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK0_046
Plasmid#123976PurposeEncodes the Cas9 Thal5.10-2_hg18 homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemhDepositorInserthThal5.10-2_hg18 CAS9 Destination - HygroR
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCjedCas9
Plasmid#172216PurposeExpresses catalytically inactive Campylobacter jejuni Cas9 (CjedCas9) in bacterial cellsDepositorInsertcatalytic mutant of Cas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagMutationchanged Asp 8 to Ala and His 559 to AlaAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
Plasmid#85041PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.DepositorInsertloxP-stop-loxP
UseCRISPRExpressionMammalianAvailable sinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6d-V106W
Plasmid#215827PurposeExpress CBE6d V106W (with SpCas9) in mammalian cellsDepositorInsertCBE6d V106W-SpCas9-2xUGI (cas9 )
UseIn vitro transcription templateAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAWP78-PVCpnf_pvc13-Ad5_pvc10-Cas9
Plasmid#243733PurposePVC structural operon - tail fiber (Pvc13) retargeted with Ad5 knob - spike tip (Pvc10) loaded with Cas9 on CTDDepositorInsertpvc13-Ad5_pvc10-Cas9
ExpressionBacterialAvailable sinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R160a
Plasmid#173756PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA160aDepositorInsertCas9_sgRNA1/R160a_sgRNA2/R160a
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R160b
Plasmid#173757PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA160bDepositorInsertCas9_sgRNA1/R160b_sgRNA2/160b
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R390a
Plasmid#173758PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA390aDepositorInsertCas9_sgRNA1/390a_sgRNA2/390a
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
1098E=TI-pgSIT[tra,bTub,Hasp70Bb-Cas9]
Plasmid#149427PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[TraB, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL1P1_AtU626Ter26
Plasmid#191769PurposeCas9 guide expression in dicotsDepositorInsertSpCas9 guide scaffold with AtU626 promoter/terminator
UseCRISPRExpressionPlantAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL1P3_AtU626Ter26
Plasmid#191771PurposeCas9 guide expression in dicotsDepositorInsertSpCas9 guide scaffold with AtU626 promoter/terminator
UseCRISPRExpressionPlantAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiH (CRONUS-Hygro)
Plasmid#100597PurposepiggyBac vector expressing Dual-regulated Cas9 (Hygro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…Available sinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
BCJJ125
Plasmid#117515PurposeCas9_3 (with intron) Golden Gate Level 0DepositorInsertBsaI:AATG:Cas9_3(intron):GCTT:BsaI
UseCRISPRTags2xFLAG and NLSExpressionPlantAvailable sinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by