We narrowed to 14,506 results for: SHR;

#76893

3rd generation lentiviral gRNA plasmid targeting human PIKFYVE

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#195194

dual gRNAs for deletion of OR2M4 in a third generation Cas9 backbone with GFP

Jason Sheltzer

Girish et al Science. 2023 Jul 6:eadg4521. doi: 10.11

Feb. 14, 2023

Academic Institutions and Nonprofits only

#106809

expression of gRNA targeting EXTL3

Eric-Paul Bennett

Narimatsu et al Glycobiology. 2018 Jan 5. pii: 4791732.

Nov. 9, 2018

Academic Institutions and Nonprofits only

#77667

3rd generation lentiviral gRNA plasmid targeting human PIP5K1C

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#107921

nat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacer

Jean-Marc Daran

Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov

June 5, 2018

Academic Institutions and Nonprofits only

#183876

pX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.

Alisa Piekny

Husser et al Open Biol. 2022 Nov;12(11):220247. doi:

April 21, 2023

Academic Institutions and Nonprofits only

#139457

Lentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable marker

Caroline Goujon

Doyle et al Nat Microbiol. 2018 Dec;3(12):1369-1376.

Oct. 13, 2020

Academic Institutions and Nonprofits only

#139458

Lentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable marker

Caroline Goujon

Doyle et al Nat Microbiol. 2018 Dec;3(12):1369-1376.

Aug. 12, 2020

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only