We narrowed to 29,631 results for: Ide
-
Plasmid#136469PurposeMammalian expression of mitochondrial intermembrane space targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsSMAC/DIABLOExpressionMammalianMutationPromoterCMV, SP6Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionTagsExpressionMutationPromoterArabidopsis U6 polymerase III promoterAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GASTM-3-RVG-10-Lamp2b-HA
Plasmid#71295PurposeEncodes (N to C): GASTM mutated glycosylation motif, 3 residue spacer, RVG peptide,10 residue spacer, Lamp2b (exosomal membrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
UseTagsGASTM mutated glycosylation motif, HA, Lamp2 sig…ExpressionMammalianMutationPromoterCMVAvailable sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
FCM101
Plasmid#194298PurposeE. coli expression vector for monobody adaptor, FCM101, that bind to the Fc region of mouse IgG1 subclass. It contains a single Cys residue at the C-terminus for chemical conjugation, N-terminal His6DepositorInsertFCM101
UseTagsHis tag, FLAG tagExpressionBacterialMutationPromoterT7Available sinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p35S_EVDm1
Plasmid#167121PurposePlant binary expression vector containing the coding sequence of the Arabidopsis Copia93 retroelement EVADE (AT5G17125) with U1 binding site mutated under CaMV 35S promoter.DepositorInsertEVADE (EVD) (AT5G17125 Mustard Weed)
UseTagsExpressionPlantMutationmutated four nucleotides at the snoRNA U1 binding…PromoterCaMV 35SAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FRA1
Plasmid#188665PurposeExpresses murine FRA1 (Fosl1)DepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationPromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#1)
Plasmid#166240PurposesgRNA (#1) to generate a knockout of human CRBN by targeting the middle region of Exon1DepositorInsertCRBN (CRBN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorInserthu Mcl-1.1 (MCL1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterH1tAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorInsertCRBN (CRBN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer-FRA1
Plasmid#192267PurposeDoxycycline-inducible expression of murine FRA1 (Fosl1)DepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviral; Inducible expressionTagsExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_S5E2_Chrimson_tdTomato
Plasmid#219432PurposeAAV construct expressing Chrimson-tdTomato under the control of E2 regulatory elementDepositorInsertChrimson-tdTomato
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG-FRA1
Plasmid#188742Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG systemDepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsFKBP F36V tag (dTAG)ExpressionMammalianMutationPromoterhPGK promoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7vB4
Plasmid#113073PurposePlasmid for highly efficient expression of engineered IL24 with binding affinity to cognate receptorsDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
UseTagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
UseTagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AtRaf1/Raf2/RbcX2/BSD2/RbcX1
Plasmid#229510PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,RbcX2,BSD2,RbcX1DepositorInsertsUseTagsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available sinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only