Skip to main content

We narrowed to 30,438 results for: Ide

Showing: 2161 - 2180 of 30438 results
  1. pcDNA GNSTM-3-RVG-10-Lamp2b-HA

    Plasmid
    #71294
    Purpose
    Encodes (N to C): GNSTM glycosylation motif, 3 residue spacer, RVG peptide, 10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.
    Depositor
    Insert
    Lamp2b (LAMP2 Human)
    Tags
    GNSTM glycosylation motif, HA, Lamp2 signal pepti…
    Expression
    Mammalian
    Promoter
    CMV
    Available Since
    Dec. 10, 2015
    Availability
    Academic Institutions and Nonprofits only
  2. pB1H2 UV5 Zif268-cons (2-hybrid bait plasmid)

    Plasmid
    #128164
    Purpose
    UV5 promoter drives expression of Zif268-consensus peptide fusion. Pair with pGHUC w-ERBIN as a positive control (turns on HIS3/GFP).
    Depositor
    Insert
    10 amino acid glycine/serine linker + ERBIN PDZ consensus ligand (WETWV)
    Use
    Synthetic Biology
    Tags
    FLAG and zif268
    Expression
    Bacterial
    Promoter
    UV5
    Available Since
    Jan. 3, 2020
    Availability
    Academic Institutions and Nonprofits only
  3. pIA123

    Plasmid
    #234038
    Purpose
    E. coli-C. difficile shuttle vector for CRISPR editing in C. difficile. Pxyl::Cas9-opt Pgdh::sgRNA-cdr_0985. PstI site to add DNA for homology directed repair. MscI and NotI for replacement of sgRNA.
    Depositor
    Inserts
    Cas9
    sgRNA
    Use
    CRISPR
    Expression
    Bacterial
    Promoter
    Pgdh and Pxyl
    Available Since
    March 19, 2025
    Availability
    Academic Institutions and Nonprofits only
  4. p426_Cas9_gRNA-CAN1y

    Plasmid
    #87391
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  5. p425_Cas9_gRNA_LEU_1014a

    Plasmid
    #87407
    Purpose
    p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  6. p426_Cas9_gRNA-YPRCd15c

    Plasmid
    #87404
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  7. p426_Cas9_gRNA-ARS208a

    Plasmid
    #87383
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  8. pB1H2 UV5 Zif268-5ala (2-hybrid bait plasmid)

    Plasmid
    #128165
    Purpose
    UV5 promoter drives expression of Zif268-5alanine peptide fusion. Pair with pGHUC w-ERBIN as a negative control (doesn't turn on HIS3/GFP).
    Depositor
    Insert
    10 amino acid glycine/serine linker + 5alanines
    Use
    Synthetic Biology
    Tags
    FLAG and zif268
    Expression
    Bacterial
    Promoter
    UV5
    Available Since
    Jan. 3, 2020
    Availability
    Academic Institutions and Nonprofits only
  9. p426_Cas9_gRNA-ARS416d

    Plasmid
    #87386
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  10. p426_Cas9_gRNA-ARS106a

    Plasmid
    #87382
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  11. p426_Cas9_gRNA-ARS1114a

    Plasmid
    #87397
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  12. p426_Cas9_gRNA-ARS308a

    Plasmid
    #87384
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  13. p426_Cas9_gRNA-HIS3b

    Plasmid
    #87402
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  14. p426_Cas9_gRNA-ARS1309a

    Plasmid
    #87399
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  15. p426_Cas9_gRNA-ARS1622b

    Plasmid
    #87403
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  16. p426_Cas9_gRNA-ARS911b

    Plasmid
    #87394
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  17. p426_Cas9_gRNA-ARS720a

    Plasmid
    #87392
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  18. p426_Cas9_gRNA-ARS1021b

    Plasmid
    #87395
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  19. p426_Cas9_gRNA-ARS1014a

    Plasmid
    #87396
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  20. p426_Cas9_gRNA-YOLCd1b

    Plasmid
    #87401
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
Showing: 2161 - 2180 of 30438 results