We narrowed to 3,290 results for: cmv promoter
-
Plasmid#241369PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLVX-IRES-PURO-RAC1-Y64F
Plasmid#241370PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rock1-GBD (840-110 aa) in pEGFPN1
Plasmid#187279PurposeExpress EGFP-Rock1 GTPase-binding domainDepositorAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Ub-VPS13D
Plasmid#176462Purposeexpressing GFP-Ub marked VPS13D in mammalian cells. GFP-Ub will be cleaved by DUBs to express untagged VPS13DDepositorAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Ub-VPS13D N3521S
Plasmid#176463Purposeexpressing VPS13D patient mutant N3521S in mammalian cellsDepositorInsertVPS13D (VPS13D Human)
UseTagsGFP-UbExpressionMammalianMutationN3521S mutationPromoterCMVAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-Tapasin-TAPBPR 22-35
Plasmid#153478PurposeMammalian expression of FLAG-tagged Tapasin with TAPBPR a.a. 22-35DepositorInsertTAPBP (TAPBP Human)
UseTagsFLAGExpressionMammalianMutationTapasin a.a.10-20 replaced with TAPBPR a.a. 22-35PromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-N-Myc-Flag-BirA-hPOT1-DeltaOB
Plasmid#166410Purposeexpress BirA-hPOT1 ΔOB in mammalian cellsDepositorAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
NanoBRET BiBRET Vector, NanoLuc-KRAS(G12D)_CRAF(RBD-CRD)-HaloTag
Plasmid#238576PurposeExpress NanoLuc-KRAS(G12D)_CRAF(RBD-CRD)-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationG12DPromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector, NanoLuc-KRAS WT-CRAF RBD-CRD-HaloTag
Plasmid#236865PurposeExpress NanoLuc(R)-KRAS WT-CRAF RBD-CRD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector HaloTag-KRAS 2B WT-BRAF RBD-NanoLuc
Plasmid#236853PurposeExpress HaloTag(R)-KRAS 2B WT-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
L1-neo-TET
Plasmid#51284Purposeexpresses codon optimized human L1 retrotransposon driven by CMV promoter and tagged with the self splicing intron neo cassetteDepositorInsertL1RE1 (L1RE1 Human)
UseTagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianMutationPromoterCMVAvailable SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-CRBN-P2A-Hygro
Plasmid#124303PurposeLentiviral vector for expression of Flag tagged CRBN-P2A-Hygro casette from a CMV promoterDepositorAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 F-tractin-EGFP
Plasmid#58473PurposeExpresses a cytoplasmic actin filament reporter, the neuronal inositol 1,4,5-triphosphate 3-kinase A actin-binding domain known as F-tractin, on a CMV promoterDepositorAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_IRES_tdTomato
Plasmid#184046PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using an IRES sequenceDepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Internal Ribosome Entry Site
UseTagsExpressionMammalianMutationPromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianMutationPromoterCMVAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
TAK11
Plasmid#227095PurposeLuciferase reporter vector with HIV-1 TAR region cloned in pGL3 Basic vectorDepositorInsertCMV Promoter and HIV-1 TAR region
UseLuciferaseTagsExpressionMutationPromoterCMVAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_D2A_tdTomato
Plasmid#184045PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using a dual 2A peptide sequence (P2AT2A)DepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Dual 2A Peptide Sequence
UseTagsExpressionMammalianMutationPromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-CUL4A WT-P2A-Puro
Plasmid#124304PurposeLentiviral vector for expression of wild-type CUL4A-P2A-Puro casette from a CMV promoterDepositorAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only