We narrowed to 170,472 results for: addgene
-
Plasmid#222606PurposeExpression of MAC3-tagged GFP-NES (N-terminal)DepositorInsertEGFP and 3' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-NTRK3
Plasmid#222612PurposeExpression of MAC3-tagged NTRK3DepositorAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-NLS
Plasmid#222607PurposeExpression of MAC3-tagged GFP-NLS (N-terminal)DepositorInsertEGFP and 3' nuclear localizaition sequence (NLS)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-NES
Plasmid#222603PurposeExpression of MAC3-tagged GFP-NES (C-terminal)DepositorInsertEGFP and 5' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-Myr
Plasmid#222608PurposeExpression of MAC3-tagged GFP-Myr (N-terminal)DepositorInsertEGFP and 3' myristoylation sequence (Myr)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-Myr
Plasmid#222605PurposeExpression of MAC3-tagged GFP-Myr (C-terminal)DepositorInsertEGFP and 5' myristoylation sequence (Myr)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
LEGO-pDHS-AP1x6-GM55
Plasmid#217416PurposeLuciferase expression vector with 6 AP-1 sites and the minimal GM-CSF promoter, and a chromatin priming element. Alias: LEGO-GM55-AP-1x6-pDHS(IL-3)DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoter6 AP-1 sites, Human -55 to +28 minimal CSF2 promo…Available SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLEKHA3 (FAPP1) g2 lentiCRISPRv2-opti
Plasmid#218657PurposeKnockout vector for human PLEKHA3 (FAPP1)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLEKHA3 (FAPP1) g1 lentiCRISPRv2-opti
Plasmid#218656PurposeKnockout vector for human PLEKHA3 (FAPP1)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CMV-SCLM
Plasmid#216758PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleonDepositorInsertSuperClomeleon followed by WPRE and human growth hormone polyA terminator
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCMV (cytomegalovirus)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only