We narrowed to 18,622 results for: Met;
-
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAP684-3
Plasmid#99489PurposeTEV::eGFP::ER::Ollas::linker::3XFlagDepositorInsertTEV::eGFP::RE::Ollas::linker::3XFlag
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGR-L3S2P36
Plasmid#46007DepositorInsertL3S2P36 Terminator
UseSynthetic BiologyExpressionBacterialPromoterPBADAvailable SinceJune 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
MlumB10
Plasmid#245863PurposeArchael (Methanomassiliicoccus luminyensis B10) 16S rRNA expressionDepositorInsert16S rRNA
UseOtherAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCB70
Plasmid#245856PurposeArchael (Methanosuratincola verstraetei LCB70) 16S rRNA expressionDepositorInsert16S rRNA
UseOtherAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCB24
Plasmid#245855PurposeArchael (Methanoglobus hypatiae LCB24) 16S rRNA expressionDepositorInsert16S rRNA
UseOtherAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PaPchF-AMT
Plasmid#242104PurposeAdenylase-methyltransferase didomain of the nonribosomal peptide synthetase Pchf from Pseudomonas aeruginosa for the production of pyochelinDepositorInsertPaPchF-AMT
Tags6xHisExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1553
Plasmid#238470PurposepMOBC360_VL: Vector Left (VL) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1554
Plasmid#238471PurposepMOBC360_VR: Vector Right (VR) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1525
Plasmid#226496PurposepMOBC360_VM: Vector Middle (VM) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1520
Plasmid#221581PurposepMOBK360_VR: Vector Right (VR) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1518
Plasmid#221579PurposepMOBK360_VL: Vector Left (VL) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1519
Plasmid#221580PurposepMOBK360_VM: Vector Middle (VM) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUASTattB-cytoFLARE1.0-TEV
Plasmid#234519PurposeTranscriptional reporter for detecting calcium transients in Drosophila larvae (TEVp)DepositorInsertCaM-V5-TEVp
ExpressionInsectAvailable SinceMay 1, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
T7-LacO-Halo-STReTCh-RGD
Plasmid#216532PurposeExpresses HaloTag-STReTCh-RGD fusion protein in bacteriaDepositorInsertHaloTag-STReTCh-RGD
Tags6xHis and HaloTagExpressionBacterialAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEB2-2ndVal DsRedEx2
Plasmid#104024PurposePlasmid encoding 2ndVal DsRed-Express2DepositorInsert2ndVal DsRed-Express2
UseLow copyExpressionBacterialMutationDsRed-Express2 with valine inserted in 2nd positiā¦PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP757-1
Plasmid#99493Purpose6XHis::TEV::3XFlag::linker::MycDepositorInsert6XHis::TEV::3XFlag::linker::Myc
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP605-1
Plasmid#99482PurposeMyc::TEV::3XFlag::TEV::MycDepositorInsertMyc::TEV::3XFlag::TEV::Myc
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only