We narrowed to 3,367 results for: aaas
-
Plasmid#64648Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralPromoterPGKAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg2
Plasmid#139451PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Ptpn23-g1)-PGKpuroBFP-W
Plasmid#105034PurposeLentiviral gRNA plasmid targeting mouse Ptpn23 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH1_2
Plasmid#36360DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCfB3051(gRNA X-3 XI-2 XII-2)
Plasmid#73293PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_Dual_pegRNA
Plasmid#173200PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLK1 G5.1 gRNA
Plasmid#90834Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorInsertPLK1 (Guide Designation G5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-CTCF-prom
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS186
Plasmid#140627PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS186. The crRNA-IS186 targets IS186 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS186
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
plKO.1-DNAJC5-ShRNA
Plasmid#205729PurposeKnockdown of DNAJC5DepositorInsertshRNA targeting DNAJC5 (DNAJC5 Human)
UseLentiviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJG367
Plasmid#91185PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, H840A double nickase (nAtCas9_H840A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_H840A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG382
Plasmid#91189PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A double nickase (nAtCas9_D10A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pInducer10-UBC9-sh4
Plasmid#168988PurposeExpresses RFP cDNA and UBC9 shRNA 4 in mammalian cellsDepositorInsertUbiquitin Conjugating Enzyme 9
ExpressionMammalianPromoterUbc promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
HcRed-pcw107-V5
Plasmid#64647Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5PromoterPGKAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EED_2
Plasmid#36386DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
Plasmid#84260PurposeExpresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulationDepositorInsertsSp sgSV40
PYL1-KRAB
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR/U6 HDAC5 shRNA
Plasmid#32222DepositorAvailable SinceSept. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only