We narrowed to 2,556 results for: neurod
-
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX-EF1a ANXA11-mEmerald
Plasmid#164210PurposepLEX lentivirus backbone expresses mEmerald tagged ANXA11 under EF1a promoterDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q145
Plasmid#111731PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ145 (polyQ repeat)PromoterCMV and P10Available SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q109
Plasmid#111730PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ109 (polyQ repeat)PromoterCMV and P10Available SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TBK1
Plasmid#23851DepositorInsertTBK1 (TBK1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-FUS/TLS-FLAGC
Plasmid#60362PurposePlasmid for expression of FLAG-GFP tagged human FUS/TLS (C-terminal tag). Confers resistance to G418.DepositorAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1 YFP
Plasmid#84912PurposeMammalian expresion of TDP-43 NLS1 YFPDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tet-off TauRD (P301L/V337M)
Plasmid#188572PurposeDox-repressible expression of the Tau repeat domainDepositorInsertTau repeat domain (MAPT Human)
UseLentiviralTagsMycExpressionMammalianMutationP301L and V337MPromoterpTight TREAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
TagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-LRRK2
Plasmid#229019PurposeExpression of untagged full length human LRRK2 in mammalian cellsDepositorInsertLeucine-rich repeat kinase 2 (LRRK2 Human)
Tagsno tags (untagged)ExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q30
Plasmid#111744PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ30 (polyQ repeat)PromoterCMV and P10Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1, 5F-L YFP
Plasmid#84913PurposeMammalian expresion of TDP-43 NLS1, 5F-L YFPDepositorInsertTDP-43 (TARDBP Human)
TagsYFPExpressionMammalianMutationK82A, R83A, K84A, F147L, F149L, F194L, F229L, F23…PromoterCMVAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7NT*-Bri2 113-231 R221E
Plasmid#138134PurposeExpresseds human Bri2 BRICHOS R221E mutant in E. coliDepositorInserthuman Bri2 BRICHOS R221E (ITM2B Human)
TagsNT* tag derived from spider silk proteinsExpressionBacterialPromoterT7Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APP-mGFP
Plasmid#196704PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmCherry and mEGFPExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag TBK1
Plasmid#20648DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF2
Plasmid#141189PurposeExpresses GFP-GIGYF2 in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
mBFP-APP-mGFP
Plasmid#196694PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmEGFP and mtagBFP2ExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q42
Plasmid#111746PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ42 (polyQ repeat)PromoterCMV and P10Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q54
Plasmid#111727PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ54 (polyQ repeat)PromoterCMV and P10Available SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only