We narrowed to 10,377 results for: plasmids 101
-
Plasmid#184592Purposenon-standard AAV2 rep-AAV9.452sub.LUNG1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification system for mouse lung transduction after intravenous injectionDepositorInsertSynthetic construct isolate AAV9.452sub.LUNG1 VP1 gene
UseAAVExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA
Plasmid#55201PurposePlasmid encoding the Ribozyme/gRNA architecture. This is a modified form of the original plasmid described in the paper (Construct 13). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
AA0250-mCherry-2a-hM4D-nrxn1a rev
Plasmid#60544PurposeCo-expresses hM4Dnrxn and a red fluorescent label from a Cre-dependent virusDepositorInsertsUseAAV and Cre/LoxTags2xHAPromoterCAGAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xU6-PylT M15 (UUA) sfGFP 150TAA
Plasmid#154775Purposeplasmid with 4xMma PylT (M15 mutant, UUA anticodon) cassette and ochre suppression reporter sfGFP 150 TAA stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAA in GFP reporter, UUA anticodon and G10A, …PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
B52 + SPRTN sgSTOP
Plasmid#100709PurposeB52 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAG 150TAA
Plasmid#154776Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAG 150 TAA stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAG 150TAA in GFP reporter, hybrid PylT with A…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 150TAG
Plasmid#154772Purposeplasmid with 4xhybrid PylT cassette (Mx1201 G1 PylT hybrid mutant A41AA C55A) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in GFP reporter, hybrid PylT with A41AA an…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAA 150TAG
Plasmid#154777Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAA 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAA 150TAG in GFP reporter, hybrid PylT with …PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
B52 + TIMELESS sgSTOP
Plasmid#100713PurposeB52 plasmid expressing TIMELESS sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting TIMELESS (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSN67
Plasmid#100124Purposeexpresses putative KLF4 DBD with a 6xHis tagDepositorInsertmCherry-P2A-putative KLF4 DBD with a 6xHis tag (KLF4 Human)
UseLentiviralExpressionMammalianMutationInsert corresponds to the DBD of KLF4Available SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PIK3R1 sgSTOP
Plasmid#100714PurposeB52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PIK3R1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC260-P3F8
Plasmid#203101PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC260DepositorInsertEGFP/BC260
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cytoFLARE1.0/1.1-TF
Plasmid#234516PurposeTranscriptional reporter for detecting calcium transients in neuronal cultures (transcription factor)DepositorInsertERT2-MK2-hLOV-TEVcs-FLAG-tTA
UseAAVExpressionMammalianAvailable SinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.hSynapsin.TagBFP-P2A-Pre-SPHERE-SF-iGluSnFR
Plasmid#187101PurposeGlutamate sensor for localization to membrane contatctDepositorArticleInsertPre-SPHERE-SF-iGluSnFR
UseAAVTagsTagBFP-P2AExpressionMammalianPromoterhSynAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS316-OsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
Plasmid#198417PurposeExpresses both OsTIR1F74A and mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeastDepositorInsertOsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
ExpressionYeastPromoterADH1 promoterAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
T7-AglC-His6
Plasmid#89726PurposeExpresses AglC from M. voltae with an N-terminal T7 tag and a C-terminal His6 tag. Plasmid has codons optimized for E. coli expression.DepositorInsertAglC
TagsHis6 and T7ExpressionBacterialAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
T7-AglK-His
Plasmid#89714PurposeExpresses AglK from M. voltae with an N-terminal T7 tag and a C-terminal His6 tag. Plasmid has codons optimized for E. coli expression.DepositorInsertAglK
TagsHis6 and T7ExpressionBacterialAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLC25A13-APEX2
Plasmid#228198Purposeplasmid encoding human SLC25A13 with an APEX protein tagDepositorAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only