We narrowed to 11,999 results for: SHA
-
Plasmid#214230PurposeBacterial expression of SH2 domain of the cSrc kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertcSrc kinase SH2 domain (SRC Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti.PGK.blast-Flag-MFF-S155,172D
Plasmid#74442PurposeLentiviral expression vector containing flag tagged S155,172D MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseLentiviralTagsFlagExpressionMammalianMutationSer 155 Asp, Ser 172 Asp (Numbering based on MFF …Available SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Spliced (1-938) pEF6-Flag (MJS_015)
Plasmid#73268Purpose[Edit] Expression of mouse HDAC7-S (1-938) in mammalian cells (Flag tag)DepositorAvailable SinceFeb. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Spliced (1-938) pEF6-V5 (MJS_014) [Edit]
Plasmid#73267PurposeExpression of mouse HDAC7-S (1-938) in mammalian cells (V5 tag)DepositorAvailable SinceFeb. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag2-Sox9 T236A/T240A
Plasmid#111458PurposeTransient expression of Flag-tagged human Sox9 with T236A/T240A mutationDepositorAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL4.27_eSOX17
Plasmid#195498PurposeFirefly luciferase enhancer expression vector driven by a minimal CMV-promoter and the extended endoderm distal enhancer of human SOX17DepositorInsertFull distal endoderm enhancer region of SOX17 (SOX17 Human)
TagsminP_luc2-hPESTExpressionMammalianAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.27_eSOX17.2
Plasmid#195499PurposeFirefly luciferase enhancer expression vector driven by a minimal CMV-promoter and the core endoderm distal enhancer of human SOX17DepositorInsertCore distal endoderm enhancer region of SOX17 (SOX17 Human)
TagsminP_luc2-hPESTExpressionMammalianAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Unspliced (23-938) pEF6-V5 (MJS_017)
Plasmid#73266PurposeExpression of mouse HDAC7-U (23-938) in mammalian cells (V5 tag)DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK3
Plasmid#138690PurposeExpresses a human MARK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti.PGK.blast-Flag-MFF-S155,172A
Plasmid#74380PurposeLentiviral expression vector containing flag tagged S155,172A MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseLentiviralTagsFlagExpressionMammalianMutationSer 155 Ala, Ser 172 Ala (Numbering based on MFF …Available SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti.PGK.blast-Flag-MFF-S155,172E
Plasmid#74443PurposeLentiviral expression vector containing flag tagged S155,172E MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseLentiviralTagsFlagExpressionMammalianMutationSer 155 Glu, Ser 172 Glu (Numbering based on MFF …Available SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB Flag MFF S155,172A
Plasmid#74387PurposeRetroviral expression vector containing Flag tagged S155,172A MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseRetroviralTagsFlagExpressionMammalianMutationSer 155 Ala, Ser 172 Ala (Numbering based on MFF …PromoterCMVAvailable SinceMay 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Nterm (23-504) pEF6-V5
Plasmid#73270PurposeExpression of mouse HDAC7-Nterm in mammalian cells (V5 tag)DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB Flag MFF S155A
Plasmid#74385PurposeRetroviral expression vector containing Flag tagged S155A MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseRetroviralTagsFlagExpressionMammalianMutationSer 155 Ala (numbering based on MFF isoform 1)PromoterCMVAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB Flag MFF S172A
Plasmid#74386PurposeRetroviral expression vector containing Flag tagged S172A MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseRetroviralTagsFlagExpressionMammalianMutationSer 172 Ala (numbering based on MFF isoform 1)PromoterCMVAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Unspliced (23-938) pEF6-Flag (MJS_018)
Plasmid#73269PurposemHDAC7-U (23-938) pEF6-V5 (MJS_017) (Flag tag)DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR
Plasmid#62575PurposeTranslational Luciferase Reporter containing a 926 bp fragment of the RASA1 3'UTR.DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125/147/213-siResist
Plasmid#49858PurposeEncodes human connexin 43 with M100, M125, M147, and M213 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100, Methionine 125, Methionine 147, an…PromoterCMVAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Lyn-SH2-AviTag
Plasmid#214207PurposeBacterial expression of SH2 domain of the Lyn kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-TEV-Grb2-SH2-mCherry-AviTag
Plasmid#214231PurposeBacterial expression of SH2 domain of the Grb2 with N-terminal TEV-cleavable 6xHis tag, C-terminal mCherry, and C-terminal AviTag for Streptavidin bead functionalization for binder selections.DepositorInsertGrb2 SH2 domain (GRB2 Human)
Tags6xHis, AviTag, and mCherryExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Lck-SH2-AviTag
Plasmid#214203PurposeBacterial expression of SH2 domain of the Lck kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertLck kinase SH2 domain (LCK Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Blk-SH2-AviTag
Plasmid#214204PurposeBacterial expression of SH2 domain of the Blk kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertBlk kinase SH2 domain (BLK Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Hck-SH2-AviTag
Plasmid#214206PurposeBacterial expression of SH2 domain of the Hck kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HP1γ-ΔCSD-EGFP
Plasmid#179934PurposeC terminal fusion of EGFP to mouse HP1γ (Cbx3) containing deletion of entire chromoshadow domain (ΔCSD)DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_allW
Plasmid#224252PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_allWDepositorInserthnRNPA1_allW (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationF17W,F25W,F31W,F37W,F43W,Y52W, Y59W, F62W, F69W, …PromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK845
Plasmid#219746PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 codon-optimised for expression in Pichia pastoris, Homo sapiensDepositorInsertmutant of fungal luciferase
UseLuciferase and Synthetic BiologyMutationI3S, N4T, F11L, I63T, T99P, T192S, A199PAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCDF Bravo-PotH-OL3/2sub
Plasmid#216752PurposeStudy the interaction of PotH in E. coli, specifically focusing on the variant in which outer loop 2 (OL2) is substituted with OL3 in its interaction with exogenous peptides.DepositorInsertpotH (potH E. coli (Bacteria))
Tags10x HisExpressionBacterialMutationOuter loop 2 (OL2) with the sequence of [WMGILKNN…Available SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only