We narrowed to 4,373 results for: AR
-
Plasmid#158230PurposeRetroviral expression plasmid of sgRNA with violet-excited fluorescent protein (VEX)DepositorTypeEmpty backboneUseCRISPR and RetroviralTagsExpressionMammalianMutationPromoterU6 promoter for crRNA expression and EFS promoter…Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only
-
P521_VSX2_p2A-h2b_mRuby3
Plasmid#239104PurposeUsed in CRISPR gene editing to Insert a p2A-h2b_mRuby3 sequence before the stop codon of the endogenous human VSX2 geneDepositorInsertVSX2 (VSX2 Human)
UseCRISPRTags-p2A-h2b-mRuby3ExpressionMammalianMutationPromoterEndogenous VSX2 promoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBig1a zz TEV YBBR POT1 MBP TEV TPP1 MBP TEV TIN2 ZZ TEV TRF2 (4comp2)
Plasmid#185448PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF2 with a zz tag and TEV site, and human TIN2 and TPP1 each with an MBP affinity tag and TEV site in insect cellsDepositorUseTagsMBP, YBBR, and ZZExpressionInsectMutationSee Depositor Comments BelowPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-tdTomato-WPRE
Plasmid#51503PurposeCan be used to generate AAV virus that will express tdTomato in the presence of CreDepositorInserttdTomato
UseAAVTagsExpressionMutationPromoterpCAGAvailable sinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA_N-human Prkd2 without kinase domain
Plasmid#138411PurposeExpress Prkd2 without kinase domain in mammalian cellsDepositorInsertPrkd2 without kinase domain (PRKD2 Human)
UseTagsHAExpressionMammalianMutationkinase domain deleted from human Prkd2PromoterCMVAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-DreO-bGHpA
Plasmid#50363PurposeCan be used to generate AAV virus that will express DreO recombinase in neurons from the synapsin promoterDepositorHas ServiceAAV Retrograde and AAV5InsertDreO recombinase
UseAAVTagsnoneExpressionMutationSequence optimized for expression in mammalian ce…PromoterhSyn1Available sinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
Rasgrf2-2A-dCre targeting vector
Plasmid#61573PurposeTarget a DHFR-destabilized Cre recombinase gene to the stop codon of the mouse Rasgrf2 geneDepositorInsertRasgrf2-2A-dCre (Rasgrf2 Mouse, P1 bacteriophage)
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMarch 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 N-term LMNA
Plasmid#187576PurposeExpress FLAG epitope and APEX2-tagged LMNA fusion protein in mammalian cellsDepositorInsertLMNA (LMNA Human)
UseTagsAPEX2-FLAGExpressionMammalianMutationPromoterCMVAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Slc17a7-IRES2-Cre targeting vector
Plasmid#61574PurposeTarget the Cre recombinase gene to the stop codon of the mouse Slc17a7 (VGlut1) geneDepositorInsertSlc17a7-IRES2-Cre
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSL21-mCherry
Plasmid#164410PurposeRetroviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and RetroviralTagsExpressionMammalianMutationPromoterU6 promoter for crRNA expression and EFS promoter…Available sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.LSL.EGFP
Plasmid#100047PurposeAAV mediated Cre-dependent expression of EGFP (Lox-Stop-Lox)DepositorInsertEGFP
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-MCU-Flag-TetOFF
Plasmid#185657PurposeTet/dox-repressible expression of C-terminus Flag tagged human mitochondrial calcium uniporterDepositorInsertMitochondrial calcium uniporter (MCU Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterpTight TREAvailable sinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.LSL.tdTomato
Plasmid#100048PurposeAAV mediated Cre-dependent expression of tdtomato (Lox-Stop-Lox)DepositorInserttdtomato
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FlpO-bGHpA
Plasmid#51669PurposeCan be used to generate AAV virus that will express the FlpO recombinase gene in neurons from the synapsin promoter.DepositorHas ServiceAAV RetrogradeInsertFlpO recombinase gene
UseAAVTagsExpressionMammalianMutationPromoterhSyn1Available sinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA_N-mouse Bcl6
Plasmid#138410PurposeExpress mouse Bcl6 in mammalian cellsDepositorInsertB cell lymphoma 6 (Bcl6 Mouse)
UseTagsHAExpressionMammalianMutationPromoterCMVAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgp53
Plasmid#227947PurposesgRNA targeting p53, GFP, neomycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorInsertTp53 (Trp53 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-CTID195-GSQ-UBnc-PURO
Plasmid#208037PurposeEnables inducible expression of C-terminal Split-TurboID-fused UBnc, to perform Ubiquitin-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertUbnc (UBC Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDExpressionMutationL73P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ai62(TITL-tdT) Flp-in replacement vector
Plasmid#61576PurposeRecombinase-mediated cassette exchange in ES cells to insert a Cre & tTA-dependent tdTomato expression cassette into a docking site within the mouse TIGRE genomic locusDepositorInsertchromatin insulator flanked TRE-LSL-tdTomato
UseRecombinase-mediated cassette exchange using flp …TagsExpressionMutationPromoterAvailable sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-CTID195-GSQ-SUMO1nc-PURO
Plasmid#208035PurposeEnables inducible expression of C-terminal Split-TurboID-fused SUMO1nc, to perform SUMO-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO1nc (SUMO1 Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDExpressionMutationQ94P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only