We narrowed to 12,465 results for: cel.2;
-
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLYS6-METTL17-LYRMut-FLAG
Plasmid#220877PurposeExpressing METTL17-LYRMut-FLAGDepositorInsertMETTL17 (METTL17 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationChanged the LYP domain to AAAAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-LCB3_v1.2-PDGFR-T2A-mCherry (pZYW049)
Plasmid#194232PurposeLentiviral expression vector expressing LCB3 on the cell surface attached to PDGFR's transmembrane domain and mCherry transduction markerDepositorInsertEF1a-LCB3-PDGFR TMD-T2A-mCherry
UseLentiviralPromoterEF1aAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-CUP1-His6-CUbo(K48R)-GFP
Plasmid#212793PurposeCopper-inducible expression of the artificial test substrate His6-CUbo(K48R)-GFP in budding yeastDepositorInsertHis6-CUbo(K48R)-GFP
UseIntegrative vectorExpressionYeastMutationCUb(K48R)PromoterCUP1Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-CUP1-His6-CUbo(K63R)-GFP
Plasmid#212794PurposeCopper-inducible expression of the artificial test substrate His6-CUbo(K63R)-GFP in budding yeastDepositorInsertHis6-CUbo(K63R)-GFP
UseIntegrative vectorExpressionYeastMutationCUb(K63R)PromoterCUP1Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48) aa24-150-VSV
Plasmid#212747PurposeConstitutive expression of NUbo-E3(48)ΔU7BD-VSV in budding yeast, inactive E3(48)DepositorInsertE3(48) aa24-150
UseIntegrative vectorTagsNUbo and VSVExpressionYeastMutationCue1 ΔU7BDPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1) C885A-CUbo-VSV
Plasmid#212738PurposeConsitutive expression of myc-E3(1) C885A-CUbo-VSV in budding yeast, catalytic inactive E3(1)DepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-NLS-VSV and mycExpressionYeastMutationHOIP(C885A)PromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iEscSnFR_PM
Plasmid#182813PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iEscSnFR_cyto
Plasmid#182814PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_cyto
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iFluoxSnFR_ER
Plasmid#182815PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_ER
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iFluoxSnFR_PM
Plasmid#182816PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iFluoxSnFR_cyto
Plasmid#182817PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_cyto
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_ER
Plasmid#182818PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_ER
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_PM
Plasmid#182819PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_PM
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_cyto
Plasmid#182820PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_cyto
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_ER
Plasmid#182821PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_ER
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_PM
Plasmid#182822PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_PM
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_cyto
Plasmid#182823PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_cyto
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iEscSnFR_ER
Plasmid#182812PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_ER
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT3038
Plasmid#122545PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a lysosomal related organelle localized gene (glo-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT3043
Plasmid#122546PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a autophagic localized gene that is orthologus to mamalian LC3 (sqst-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 p37delta2-81
Plasmid#113502PurposeBacterial expression of GST-tagged p37 lacking the N-terminal AA 2-81DepositorInsertp37 (Ubxn2b Mouse)
TagsGST-PreScission protease siteExpressionBacterialMutationdelta 2-81Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_cGAS_gRNA_3
Plasmid#235531PurposegRNA against human cGASDepositorInsertcGAS (CGAS Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-TRIM21
Plasmid#207838PurposeInducible TRIM21 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsTagsweak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304 Flag-mCherry-eEF1A1_IRES-GFP
Plasmid#198383PurposeeEF1A1 fluorescent reporterDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEND-351_Cacnes_dCas9_CRISPRi
Plasmid#225617PurposeCutibacterium acnes replicative plasmid with dCas9 for CRISPRi. pBRESP36A-based vector optimized for reduced size and modular assembly, harbouring a medium-copy pBR322 E. coli ori (no ROP)DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-Grik1-GFP
Plasmid#233645PurposeExpresses GFP in OFF cone bipolar cellsDepositorInsertGrik1 promoter (Grik1 Mouse)
UseAAVAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3 GCN1 R2312A-3xFlag_IRES-iRFP
Plasmid#198389PurposeGCN1 R2312A expressonDepositorInsertGCN1 (GCN1 Human)
UseLentiviralTags3xFlagExpressionMammalianMutationR2312A mutation in RWDBD (RWD binding domain)PromoterCMVAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
CD69-His-bio
Plasmid#52328PurposeExpresses full-length C-type lectin domain family 2 member C ectodomain in mammalian cells. N-terminal His tag, biotinylation sequence and rat Cd4d3+4 tag.DepositorInsertCD69 (CD69 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-osTIR1
Plasmid#207840PurposeInducible TIR1 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsosTIR
mCherry
mAID_-VHH-GFP4
Tags3X HA-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
NanoLuc-PM-Venus
Plasmid#164786PurposeNanoluciferase (NanoLuc) targeted to the extracellular surface of the cell membrane and intracellularly labeled with monomeric Venus fluorescent proteinDepositorInsertNanoluciferase fused with the transmembrane domain of the platelet-derived growth factor receptor beta and Venus (PDGFRB Human, Oplophorus gracilirostris)
TagsNanoLuc and mVenusExpressionMammalianPromoterCMVAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-55-96
Plasmid#232014PurposeExpression of CHMP2B helix 2 attached to sfGFP.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEMS2115
Plasmid#49140PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP-WPRE
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1986
Plasmid#49117PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-iCre-WPRE
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
siRNA-resistant SigmaR1-mNeonGreen a5mut (F196A L199A F200A L203A Y206A L210A L214A Y217A)
Plasmid#226578PurposeEncodes mutant siRNA resistant SigmaR1 protein (substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationF196A, L199A, F200A, L203A, Y206A, L210A, L214A, …Available SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only