We narrowed to 2,661 results for: c-Myc-promoter
-
Plasmid#110095PurposeVector for low-level constitutive expression in mycobacteria from the Tet promoter. Lacks the Tet repressor. Contains attP for chromosomal integration. Lacks the integrase and thus remains stably integrated in the absence of antibiotic selection. Contains a C-terminal 3xFLAG to allow detection of expression levels by Western blotting.DepositorTypeEmpty backboneTags3xFLAGExpressionBacterialAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only
-
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_PE7-2A-BSD
Plasmid#234073PurposeFor lentiviral expression of PE7 with blasticidin resistanceDepositorInsertPE7
UseCRISPR and LentiviralTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF-1α core promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_PEmax-2A-MLH1dn-2A-BSD
Plasmid#234072PurposeFor lentiviral expression of PEmax with MLH1dn and blasticidin resistanceDepositorInsertPEmax-2A-MLH1dn
UseCRISPR and LentiviralTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF-1α core promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-bpNLS-hPol eta-2A-tagBFP-bGHpA
Plasmid#193968PurposeEncodes a wildtype human Pol? (eta) with P2A-tagBFP marker driven by CAG promoterDepositorAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-7guides-PGK-Puro
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-aaAFB2
Plasmid#207839PurposeInducible AFB2 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsatAFB2
mCherry
miniIAA7
VHH-GFP4
Tags3X FLAG-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Cdx2-3xT7
Plasmid#200891PurposeInducible lentiviral expression of Cdx2DepositorInsertCdx2 (Cdx2 Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-miniTurbo-NRF1-FL
Plasmid#237453PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of miniTurbo fused to full-length NRF1 isoformDepositorInsertNRF1 full length
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Eomes-3xT7
Plasmid#200888PurposeInducible lentiviral expression of EomesDepositorInsertEomes (Eomes Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 _3xHA-Ago2
Plasmid#73538PurposeInducible lentiviral expression of Ago2DepositorInsertAgo2 (Ago2 Mouse)
UseLentiviralTags3xHAExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-FLAG-AT2R-CFP
Plasmid#101660PurposeExpresses AT2R with FLAG tag and CFP in mammalian cells.DepositorInsertAngiotensin II type 2 receptor (AGTR2 Human)
TagsECFP and FLAGExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K164R)
Plasmid#72555PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK164RPromoterE1B minimal promoterAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R)
Plasmid#72554PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120RPromoterE1B minimal promoterAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
RRL.sin.cPPT.CMV/Flag-NCOA7 variant 6.IRES-puro.WPRE (CG494)
Plasmid#139447PurposeLentiviral vector to ectopically express human NCOA7 isoform 4 from CMV promoterDepositorInsertFLAG-tag NCOA7 variant 6 (coding for isoform 4, the short, interferon-inducble isoform) (NCOA7 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
RRL.sin.cPPT.SFFV/Flag-NCOA7 variant 6.IRES-puro.WPRE (CG536)
Plasmid#139443PurposeLentiviral vector to ectopically express human NCOA7 isoform 4 from SFFV promoterDepositorInsertFLAG-tag NCOA7 variant 6 (coding for isoform 4, the short, interferon-inducble isoform) (NCOA7 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterSFFVAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FRT-TO-FH-Nsp8-Nsp7_GC3opt
Plasmid#157701Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp8-Nsp7 fusion protein under control of a tetracycline-inducible promoterDepositorInsertFH-Nsp8-Nsp7_GC3opt (ORF1ab SARS-CoV-2)
TagsFlag-His8ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMCh2008_pLenti_Syn_mChe-cdc42E7-E63'UTR
Plasmid#118622Purposeexpression of mChe-tagged cdc42E7-E6-3'UTR under pSyn promoter for primary neuronsDepositorInsertcdc42E7-E6 3'UTR (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianMutationchanged ttgcttt to cggtaag (496 - 502 nt in 3…Promotersynapsin I (rat)Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX461-ABE8e-nSpCas9-Intergenic sgRNA
Plasmid#237463PurposeAll-in-one base editor expressing adenine base editor (ABE8e-nSpCas9) and gRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only