We narrowed to 9,048 results for: sgRNA
-
Plasmid#70679PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
CDKN1A sgRNA
Plasmid#138189Purpose3rd generation lentiviral gRNA plasmid targeting human CDKN1ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK_1
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgDnmt1_1
Plasmid#138347PurposeExpress guide RNA 1 for Dnmt1DepositorInsertmouse Dnmt1 sgRNA (Dnmt1 Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgDnmt1_2
Plasmid#138348PurposeExpress guide RNA 2 for mouse Dnmt1DepositorInsertmouse Dnmt1 sgRNA (Dnmt1 Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcCAST-sgRNA_entry (CJT83)
Plasmid#181785PurposeExpresses AcCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
ExpressionBacterialPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgRNA-CLTA-mCherry
Plasmid#240637PurposeVector for expressing an sgRNA targeting CLTA promoter from the mouse U6 promoter and a puromycin resistance cassette and mCherry from the EF1Alpha promoter.DepositorInsertpuro-T2A-mCherry
UseCRISPRExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
BICstim-Gag-dCAS9-VPR
Plasmid#120922Purposeencodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation.DepositorInsertGAG (FMLV)-dCAS9-VPR
TagsnoneExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_SRD5A3-mcherry
Plasmid#159782PurposeS. pyogenes sgRNA collocated with pegRNA targeting human SRD5A3 geneDepositorInsertspacer of sgRNA targeting SRD5A3 gene (SRD5A3 Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_HOXD13-mcherry
Plasmid#159793PurposeS. pyogenes sgRNA collocated with pegRNA targeting mouse HOXD13 geneDepositorInsertspacer of sgRNA targeting HOXD13 gene (HOXD13 Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pH-PABE-7-sgRNA
Plasmid#115621PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FKBP12-Gag(HIV)
Plasmid#138476PurposeExpresses FKBP12 fused Gag for packaging FRB-SpCas9 into NanoMEDIC particle.DepositorInsertHIV Gag
TagsFRBP12 and Lynn Myristolation siteExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-sgRNA-BFP-Puro
Plasmid#229013PurposePerturb Seq sgRNA vector with PiggyBac backboneDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDM002-sgRNA-lenti-ZeoR
Plasmid#200060PurposeLentiviral vector for expression of sgRNA with mCherry, zeocin resistance, BlpI + BstXI cloning sitesDepositorInsertBleomycin resistance, mCherry
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only