We narrowed to 17,777 results for: URE

#90021

To express His-tagged Dsup in bacteria

Takekazu Kunieda

Hashimoto et al Nat Commun. 2016 Sep 20;7:12808. doi: 10

May 4, 2017

Academic Institutions and Nonprofits only

#45444

ATRX expression vector

Michael Dyer

Valle-Garcia et al Springerplus. 2014 May 2;3:222. doi: 10.

May 24, 2013

Academic Institutions and Nonprofits only

#110301

Mammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)

Chris Kok-Lung Chan

Tiwari et al Nat Commun. 2018 Feb 14;9(1):677. doi: 1

May 23, 2018

Academic Institutions and Nonprofits only

#234990

Expression of transmembrane region of Neuraminidase protein fused to an anti FLAG scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG protein

Monica Gonzalez-Magaldi, Daniel Leahy

Gonzalez-Magaldi et al bioRxiv [Preprint]. 2024 Nov 28:2024.11.

April 3, 2025

Academic Institutions and Nonprofits only

#204692

This plasmid allows for inducible expression of short BRD4 isoform tagged with mNeonGreen, in mammalian cells.

Michael Rosen

Kosno et al Sci Rep. 2023 Jul 24;13(1):11907. doi: 1

Aug. 18, 2023

Academic Institutions and Nonprofits only

#234995

Expression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptor

Monica Gonzalez-Magaldi, Daniel Leahy

Gonzalez-Magaldi et al bioRxiv [Preprint]. 2024 Nov 28:2024.11.

April 22, 2025

Academic Institutions and Nonprofits only

#234987

For production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surface

Monica Gonzalez-Magaldi, Daniel Leahy

Gonzalez-Magaldi et al bioRxiv [Preprint]. 2024 Nov 28:2024.11.

April 22, 2025

Academic Institutions and Nonprofits only

#55632

Expresses Cre in Mammalian Cells

Karl Deisseroth

Fenno et al Nat Methods. 2014 Jul;11(7):763-72. doi:

July 22, 2014

Academic Institutions and Nonprofits only

#121675

Expresses Cre recombinase and HA tag in a Flp dependent fashion (fDIO)

Esteban Engel, Alexander Nectow

Schneeberger et al Cell. 2019 Jun 24. pii: S0092-8674(19)30

Feb. 12, 2019

Academic Institutions and Nonprofits only

#218797

RepCap for AAV production

Ben Deverman

Huang et al Science. 2024 Jun 14;384(6701):1220-1227

May 16, 2024

Academic Institutions and Nonprofits only