We narrowed to 370 results for: gag pol
-
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWL502-PAM
Plasmid#174382PurposePlasmids bearing protospacer sequences with functional PAM efficiently triggered CRISPR-mediated defense in cells with corresponding spacer sequence; article demonstrates use in Haloferax mediterraneiDepositorInsertPAM-spacer
UseCRISPR; Archaeal expressionExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
sg2
Plasmid#113967PurposeSingle short guide RNA targeting TACCACATTTGTAGAGGTTDepositorInsertsg2
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg2+sg3
Plasmid#113970PurposeDouble short guide RNA targeting TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA_zebrafish_mmp21
Plasmid#72890Purposeplasmid to generate guideRNA against mmp21 gene in zebrafishDepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHDM-Hgpm2
Plasmid#164441PurposeEncodes codon-optimized HIV gagpol for pseudovirus productionDepositorInsertCodon Optimized HIV-1 GagPol
ExpressionMammalianAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 Human 3' HP1a gRNA
Plasmid#127907PurposeWT Cas9 Vector targeting the 3' end of the human HP1a geneDepositorInsertgRNA for Human 3' HP1a
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
sg1+sg2+sg3
Plasmid#113969PurposeTriple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg1+sg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P NTHL1_1
Plasmid#160787PurposeSuppress NTHL1DepositorInsertshNTHL1_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-2
Plasmid#159930PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shIrak1-2
Plasmid#180398PurposeProducing AAV that encodes mouse Irak1 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 4- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210740PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 4DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only