We narrowed to 14,166 results for: ung
-
-
-
-
pEMY01AB-PRO
Plasmid#127714PurposeIntegrative yeast promoter characterization plasmid. Clone in with BpiI. Has ChrXV homology upstream and an mVenus fragment downstream.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pEMY01CD-TER
Plasmid#127751PurposeIntegrative yeast terminator characterization plasmid. Clone in with BpiI. Has mVenus fragment upstream and a KanMX fragment downstream.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pFC334
Plasmid#87846PurposeAMA1 plasmid with Aspergillus optimized Cas9, argB selection marker and yA specific sgRNA expressed with ribozymesDepositorInsertsCas9
argB
yA specific sgRNA
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterA. nidulans gpdA promoter with Hammerhead ribozym…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-WT
Plasmid#135997PurposeWT G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pFC332
Plasmid#87845PurposeAMA1 plasmid with Aspergillus optimized Cas9 and hph selection markerDepositorInsertsCas9
hph (hygromycin resistance marker)
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynI-fDIO(TagBFP)-KoNLS-Cre(MtoL)
Plasmid#180587PurposeFdCdDepositorInsertCre
UseAAVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag p21 WT
Plasmid#16240DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ-PD-L1-EGFP
Plasmid#120933PurposeExpress PD-L1-EGFP fusion protein in mammalian cellsDepositorInsertPD-L1-EGFP
ExpressionBacterialAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6A-EGFR ECD (1-644)
Plasmid#42666DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGIPz-mPD-L1
Plasmid#121488PurposeExpression of mouse PD-L1 WTDepositorInsertPD-L1
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO-EGFP-G3BP1-WT
Plasmid#136003PurposeDOX-inducible WT G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEH371 CD63 HA
Plasmid#168220PurposeMammalian expression of tetraspanin CD63 fused to a C-terminal HA tagDepositorAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-YY1
Plasmid#104395PurposeHA-YY1DepositorAvailable SinceJan. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tag5Amyc-GSK3b CA
Plasmid#16261DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCI-ASC-HA
Plasmid#41553DepositorInsertASC (PYCARD Human)
TagsHAExpressionMammalianPromoterCMV immediate-early enhancer/promoterAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only