We narrowed to 31,489 results for: REP
-
Plasmid#188708PurposesgRNA plasmid encoding hU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 NFATC2
Plasmid#188709PurposesgRNA plasmid encoding mU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
p7SK NFATC2
Plasmid#188710PurposesgRNA plasmid encoding 7SK promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 NFATC2
Plasmid#188711PurposesgRNA plasmid encoding hH1 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-Fre
Plasmid#188310PurposeExpression of Fre via a T7 promoter in TXTLDepositorInsertfre
UseSynthetic BiologyTags8x His-tagExpressionBacterialPromoterT7MaxAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-LuxC
Plasmid#188307PurposeExpression of LuxC via a T7 promoter in TXTLDepositorInsertluxC
UseSynthetic BiologyExpressionBacterialPromoterT7MaxAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-H3H
Plasmid#188303PurposeExpression of H3H via a T7 promoter in TXTLDepositorInserth3h
UseSynthetic BiologyTags8x His-tagExpressionBacterialPromoterT7MaxAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-LuxE
Plasmid#188309PurposeExpression of LuxE via a T7 promoter in TXTLDepositorInsertluxE
UseSynthetic BiologyExpressionBacterialPromoterT7MaxAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_NTRK3
Plasmid#187796PurposeMAC-tagged gene expression of human NTRK3DepositorInsertNTRK3 (NTRK3 Human)
ExpressionMammalianAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-T11HA-hMOV10-WT
Plasmid#178907Purposeexpression of WT hMOV10DepositorInsertcDNA WT hMOV10 (MOV10 Human)
TagsT11 beta strand of GFP-HAExpressionMammalianPromoterCMV promoterAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mTurbo-mito
Plasmid#187177PurposeExpress mitochondira-localized miniTurbo under the control of CAG promoterDepositorInsertmtActA fused with miniTurbo (BirA mutant)
ExpressionMammalianPromoterCAGAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-H2B-mTurbo
Plasmid#187178PurposeExpress histone H2B tagged with miniTurbo under the control of CAG promoterDepositorInserthistone H2B fused with miniTurbo (BirA mutant)
ExpressionMammalianPromoterCAGAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TARG1
Plasmid#172577PurposeFor gateway cloning of C-terminal tagged TARG1 constructs.DepositorInsertTARG1 (OARD1 Human)
UseGateway cloningAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR/zeo-TARG1
Plasmid#172574PurposeFor gateway cloning of N-terminal tagged TARG1 constructs.DepositorInsertTARG1 (OARD1 Human)
UseGateway cloningAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP64T-ythdf3-3xflag
Plasmid#164490PurposeExpresses zebrafish ythdf3 with 3x flag tag, for mRNA injectionDepositorInsertythdf3 (ythdf3 Zebrafish)
UseProduction of mrna for zebrafish injection.Tags3x-flagtagPromoterSP6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC0_3_Mxi1
Plasmid#163715PurposePlasmid encoding Mxi1 - SV40 NLS as a Type 4a part to be used in the Dueber YTK system (MoClo kit)DepositorInsertMxi1+SV40 NLS
UseSynthetic Biology; Moclo vector level 0 (type 4a)Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC0_6_sgRNA
Plasmid#163717PurposePlasmid encoding a placeholder sequence as a Type 234 part to be used in the Dueber YTK system (MoClo kit)DepositorInsertsgRNA expression cassette
UseSynthetic Biology; Moclo vector level 0 (type 234)Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC0_4_VPR
Plasmid#163716PurposePlasmid encoding VPR (VP64 - SV40 NLS - p65 - Rta) as a Type 4a part to be used in the Dueber YTK system (MoClo kit)DepositorInsertVPR
UseSynthetic Biology; Moclo vector level 0 (type 4a)Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
PylT(AGGA)Ev2 PylS mCherry-P2A-eGFP(AGGA)
Plasmid#174528PurposeDual-fluorescence reporter for quantifying PylT(AGGA)Ev2 decoding efficiencyDepositorInsertPylS
TagsFlagExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only