We narrowed to 7,077 results for: GFP expression plasmids
-
Plasmid#164249Purposeretroviral plasmid for GFP-LmnB1DepositorAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-Sst44-GFP
Plasmid#172310PurposeSST interneuron-restricted gene regulatory element GRE44, to drive GFP expression in SST+ interneuronsDepositorInsertSst44
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ACE2-GFP
Plasmid#154962PurposepcDNA3.1-ACE2-GFPDepositorAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV GG hUbV-EGFP
Plasmid#216161PurposeContains a Golden-Gate cloning cassette to express up to four gRNA and EGFPDepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRK5-vox-EGFP
Plasmid#79970Purposemammalian GFP reporter plasmid, target site for Vika recombinaseDepositorInsert2 vox-sites flanking neo in frame with EGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[N150TAA]
Plasmid#164581Purposesuperfolder GFP with N150TAA mutationDepositorInsertsfGFP-150TAA
Tags6xHisExpressionBacterialMutationN150TAA MutationPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-DQNAT
Plasmid#198210PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing an optimal DQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_DQNAT
Tags6x His Tag and DQNAT glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst22-GFP
Plasmid#172312PurposeSST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneuronsDepositorInsertSst22
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFAP-Archon-EGFP
Plasmid#187979PurposeExpresses the fluorescent voltage indicator Archon under the GFAP promoterDepositorInsertArchon1-EGFP
UseAAVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP726_L2_pV01_0I_TMV-tGFP_TCTP-fLUC
Plasmid#192406PurposeTo be a control plasmid that has no Rluc repression (replaced by turboGFP) and should reflect true off state of the circuit.DepositorInsertAct2::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only