We narrowed to 7,851 results for: 11
-
Plasmid#26282DepositorInsertMSP2
Tags6-HisExpressionBacterialMutationsynthetic gene of dimer of deletion mutant (1-43)…Available SinceApril 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRK5 mFz8CRD-IgG
Plasmid#16689DepositorAvailable SinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMRX-INU-TEX264 LIR4A-FLAG
Plasmid#128259PurposeExpresses TEX264 LIR4A in mammalian cellsDepositorInsertTEX264 LIR4A (TEX264 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationChanged FEEL (aa 273-276) to alaninesPromoterCMVAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha2
Plasmid#165859PurposeAlpha2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
EYFP-Clathrin
Plasmid#20921DepositorAvailable SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xControlgRNA
Plasmid#224583PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-V96 ELP
Plasmid#67853PurposeGFP Fluorescent Elastin-like Polypeptide(VPGVG) with 96 repeats containing Valine guest residuesDepositorInsertGFP fused to ELP (VPGVG) repeated 96 times
TagsGFP fused to N-terminal of ELPExpressionMammalianPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFosill-3
Plasmid#89697Purposeto make Fosmids that can be converted into Illumina sequencable librariesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
RhoC FLARE.sc mCer, mVenus - CA
Plasmid#65424PurposeRhoC CA biosensor single chain; mCerulean-tagged ROCK-RBD, mVenus-tagged RhoC Q63LDepositorInsertRBD, mCerulean, mVenus, RhoC
ExpressionBacterial, Insect, and Mamm…MutationT153M in mVenus, Q63L in RhoCAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
RhoC FLARE.sc mCer, mVenus - DN
Plasmid#65423PurposeRhoC DN biosensor single chain; mCerulean-tagged ROCK-RBD, mVenus-tagged RhoC T19NDepositorInsertRBD, mCerulean, mVenus, RhoC
ExpressionBacterial, Insect, and Mamm…MutationT153M in mVenus, T19N in RhoCAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFosill-2
Plasmid#89696Purposeto make Fosmids that can be converted into Illumina sequencable librariesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFBD-ESCRT 0
Plasmid#21499DepositorInsertpFastBac Dual-His/MBP/Hrs-GST/STAM1 (STAM Mouse, Human)
TagsGST and His-MBPExpressionInsectMutationnoneAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNAS1B split mCherry N-link/link-C
Plasmid#61965PurposeNegative control duet plasmid for split mCherry assembly assay (i.e., neither half of mCherry is fused to another peptide or protein)DepositorInsertsN-mCherry-link
link-C-mCherry
ExpressionBacterialPromoterPBAD and PLtetOAvailable SinceFeb. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSG424 Smad2 (Gal4-Smad2)
Plasmid#14932DepositorAvailable SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pTAJAK-71 (pESC-NatMXsyn-USER)
Plasmid#78232PurposeEmpty vector, for the insertion of gRNA expression cassettes into the vector.DepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1272
Plasmid#44486DepositorInsertMinimal Mos1, MCS
UseMultiple cloning site vectorAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pReporter_5
Plasmid#60566PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_5
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only