We narrowed to 2,568 results for: PGK
-
Plasmid#161711PurposeCMVp-EGFP-[barcode cloning site]-PGKp-Puro-WPREDepositorTypeEmpty backboneUseLentiviral and Synthetic BiologyExpressionMammalianPromoterCMV PromoterAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pEJS2194-RP_PiggyBac_SpCas9ABE8e-tracrRNA-Puro
Plasmid#211821PurposePiggyBac vector expressing SpCas9-ABE8e with tracrRNA for stable cell line establishmentDepositorInsertSpCas9-ABE8e, tracrRNA and Puromycin resistance gene
ExpressionMammalianPromoterchicken β-actin promoter, U6 promoter and hPGK pr…Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR
Plasmid#211815Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line establishmentDepositorInsertSpCas9, tracrRNA and puromycin selection gene
UseLentiviralExpressionMammalianPromoterU1a promoter, U6 promoter, and hPGK promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPrdm9#1/Cre
Plasmid#193231PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Prdm9 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPrdm9#2/Cre
Plasmid#193232PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Prdm9 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMroh2b#2/Cre
Plasmid#193220PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Mroh2b geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMroh2b#1/Cre
Plasmid#193219PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Mroh2b geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
IronFistMUT.
Plasmid#243008PurposeIron binding deficient IronFistDepositorInsertsUseGatewayTagsmNeonGreenExpressionMammalianMutationH15A, H57A, E58A, E61A, H126A, E130APromoterhuman phosphoglycerate kinase (hPGK)Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#2/Cre
Plasmid#193210PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#1/Cre
Plasmid#193209PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgHcn1#2/Cre
Plasmid#193218PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Hcn1 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-EF1-H4Δ1-19-HaloTag-IRES-Neo
Plasmid#247451PurposeExpresses H4Δ1-19-Halo under EF1 promoter and can be randomly integrated by PiggyBac transposaseDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4Δ1-19 lacks the initial 19 residues at the N-te…PromoterEF1αAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrip1#2/Cre
Plasmid#193204PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Brip1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFam135b#2/Cre
Plasmid#193214PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Fam135b geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCol22a1#2/Cre
Plasmid#193208PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col22a1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAdgb#1/Cre
Plasmid#193200PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Adgb geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAdgb#2/Cre
Plasmid#193201PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Adgb geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCol22a1#1/Cre
Plasmid#193207PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col22a1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only