We narrowed to 4,991 results for: IRES

#107544

AAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFP

Hélène Marie

Pousinha et al Elife. 2017 Jul 6;6. doi: 10.7554/eLife.

May 2, 2018

Academic Institutions and Nonprofits only

#166412

express hPOT1 K90E in mammalian cells

Agnel Sfeir

Pinzaru et al Genes Dev. 2020 Dec 1;34(23-24):1619-163

May 6, 2021

Academic Institutions and Nonprofits only

#160806

Express ISC mutant POLD1

Richard Possemato

Sviderskiy et al Mol Cell. 2020 Oct 28. pii: S1097-2765(2

Oct. 30, 2020

Academic Institutions and Nonprofits only

#133818

Encodes the C2A domain of synaptotagmin 1 for viral expression

Edwin Chapman

Courtney et al Nat Commun. 2019 Sep 9;10(1):4076. doi:

Feb. 5, 2021

Academic Institutions and Nonprofits only

#120576

Expresses Flag-RHEB fusion protein in mammalian cells & for virus production

Paul Khavari

Kovalski et al Mol Cell. 2019 Jan 4. pii: S1097-2765(18

Jan. 29, 2019

Academic Institutions and Nonprofits only

#114731

sgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc gene

Martine Roussel

Vo et al Sci Rep. 2018 Jun 7;8(1):8733. doi: 10.1

Dec. 3, 2018

Academic Institutions and Nonprofits only

#66632

co-expresses CRE excisable human MyoD and dsRed

Charles Gersbach

April 12, 2019

Academic Institutions and Nonprofits only

#105072

Targeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-333 of Mc4r and an IRES-tauGFP followed by ACNF cassette

Peter Mombaerts

Katidou et al Mol Cell Neurosci. 2018 Apr;88:138-147.

Nov. 19, 2018

Academic Institutions and Nonprofits only