We narrowed to 24,925 results for: crispr
-
Plasmid#203355PurposeDrug-inducible expression of CRISPRoff components needed for DNA methylation and gene repression with Sleeping Beauty backboneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPRoff-TetOn
Available sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWS5396-CRISPRai-KanR
Plasmid#182835PurposeSaccharomyces cerevisiae inducible CRISPRai vector - KanR markerDepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAP1-1
Plasmid#125837PurposeKO BAP1 geneDepositorInsertBAP1 (BRCA1 associated protein 1) (BAP1 Human)
UseLentiviralAvailable sinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-CBE4max-SpRYc-P2A-EGFP
Plasmid#208336PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpRYcDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized CBE4max Cas9 variant named SpRYc with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationSc++ (1-1119), SpRY (1111-1368), D10APromoterCAGAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable sinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMTP170 (pBAD33_CRISPR(Tn6900)-entry)
Plasmid#164263PurposeEntry vector for cloning user-defined spacers in the Tn6900 CRISPR array.DepositorTypeEmpty backboneExpressionBacterialPromoterArabinoseAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CRISPR_HLA_class_I_1
Plasmid#164986PurposeExpression of gRNA targeting multiple HLA-A, HLA-B, and HLA-C genesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against HLA class I
UseCRISPRExpressionMammalianAvailable sinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 2
Plasmid#70657PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorPublicationInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFS_0352_pET30-RT-CRISPR_Fusicatenibacter_saccharivorans_ARRAY_1_RC
Plasmid#116964PurposeExpresses FsRT-Cas1-Cas2 under pT7lac promoter, encodes FsCRISPR array 1 RC, compatible with SENECA acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available sinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #1-gRNA-Cas9-Puro
Plasmid#186890PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_sgCtrl#1
Plasmid#174148PurposeLentiviral vector expressing Cas9 and a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMK312 (TOP2A CRISPR)
Plasmid#140654PurposeTOP2A tagging CRISPRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTOP2A (TOP2A Human)
UseCRISPRExpressionMammalianAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro
Plasmid#208646PurposepcDNA3.1 based empty vector for transient transfection of sgRNA-cas9. U6 promoter ~ puro Res cloned from lentiCRISPRv2 (Addgene#52961), lenti virus sequences not included.DepositorTypeEmpty backboneUseCRISPRTagsClawed frog nucleoplasmin NLS, Flag, Puromycin re…ExpressionMammalianPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB4
Plasmid#197357PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only