We narrowed to 11,237 results for: AGA
-
Plasmid#242709PurposeshRNA knockdown human DLST geneDepositorInsertDLST (DLST Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-ACE2-A2
Plasmid#188687PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL22A
Plasmid#166079PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL22A for double stranded break formation in yeast.DepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMBD1.1.0-gDNA
Plasmid#132444PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertMBD1 (MBD1 Human)
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-GST
Plasmid#42049DepositorInsertGST
TagsHisExpressionBacterialAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)ExpressionBacterialPromoterT7Available SinceOct. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmPAGFP_IRES_puro2
Plasmid#21046DepositorInsertpmPAGFP
ExpressionBacterial and MammalianAvailable SinceMay 15, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_PCNA_IRES_puro2b
Plasmid#21048DepositorInserthPCNA
TagsGFPExpressionBacterial and MammalianAvailable SinceMay 15, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMyrPalm_mEGFP_IRES_puro2b
Plasmid#21038DepositorInsertpMyrPalm
TagsmEGFPExpressionBacterial and MammalianAvailable SinceMay 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-LacI
Plasmid#232636Purposelac repressor (LacI) which binds lacO sites; labeled with HaloTagDepositorInsertHaloTag-LacI
TagsNLSExpressionMammalianMutationnonePromoterCMVAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBR322 14-3-3 Promoter
Plasmid#16517DepositorInsert14-3-3 promoter (SFN Human)
ExpressionBacterialAvailable SinceJuly 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R
Plasmid#185060PurposeEf1a driven PE2 plasmid with pegRNA for editing C201R mutation in KCNQ2 gene. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hPKAalpha
Plasmid#185379PurposeFor mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alphaDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHRCMV 14-3-3 sigma
Plasmid#16552DepositorAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NQO1
Plasmid#214684PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human NQO1DepositorInsertdgRNA_NQO1 (NQO1 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL39
Plasmid#166078PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL39 for double stranded break formation in yeast.DepositorInsertPromoter of RPL39 (Overlaps with 5'UTR and first base of gene) (RPL39 Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF169.2.0-gDNA
Plasmid#112472PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF169DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only