We narrowed to 7,769 results for: aav
-
Plasmid#78174PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the human synapsin promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterhuman synapsinAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S2-cAMPr
Plasmid#160723PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter cAMPr (cAMP indicator), HA tag, and S2 protein scaffold.DepositorInsertS2-cAMPr
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.SF-Venus-iGluSnFR.A184S
Plasmid#106201PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV EGFP donor pDY0404
Plasmid#219862PurposeAAV EGFP donorDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-hDLXI56i-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231360PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with hDLXI56i enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-mscRE4-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231361PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with mscRE4 enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1002-pAAV-mscRE16-minBGpromoter-EGFP-WPRE-hGHpA
Plasmid#163486PurposeDirect-expressing EGFP AAV Virus. Alias: AiP1002 - pAAV-AiE2016m-minBG-EGFP-WPRE-HGHpADepositorInsertEGFP
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_FKBP-V5-TWIST1
Plasmid#215022PurposeAAV vector for knocking in an N-terminal tag (FKBP12F36V and V5) for human TWIST1DepositorAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Lck-mStayGold
Plasmid#234539Purposeto label the membrane of cells with a fluorescent protein (mStayGold)DepositorInsertLck-mStayGold(Ando)
UseAAVMutationNonePromoterShort CAGAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pscAAV.BC(p1-6)-CAG-EGFP-SV40pA-BC(p1-6)
Plasmid#231349PurposeSelf complementary AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ08-pAAVsc.U6-tracrRNA
Plasmid#211816PurposeAAV vector expressing tracrRNA under U6 promoterDepositorInsertU6-tracrRNA
UseAAVExpressionMammalianPromoterU6Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-eGFP-KASH
Plasmid#248781PurposeAAV construct expressing eGFP-KASH enabling FACS-sorting of extracted nucleiDepositorInserteGFP-KASH
PromoterCbhAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2A-ΔC
Plasmid#200558PurposeSecreted mouse CES2A driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2A delta C-terminal (Ces2a Mouse)
UseAAVTagsFlagPromoterTBG promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS-shCHD5 #2
Plasmid#68877PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vectorDepositorInsertCHD5
UseAAV and RNAiExpressionMammalianPromoterH1Available SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sasgRNACMV- mCherry-WPREpA
Plasmid#217015PurposeS. aureus sgRNAs backbone along with mCherry expressionDepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamKIIa-ChR2-EGFP
Plasmid#114216PurposeExpresses channelrhodopsin-EGFP fusion in CamKIIa+ neuronsDepositorInsertChannelrhodopsin 2
UseAAV and Mouse TargetingTagsEGFPExpressionMammalianPromoterCamKIIa 1.3 kbAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only