We narrowed to 3,796 results for: AES
-
Plasmid#199559PurposeGATEWAY-compatible entry vectorDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseGateway-compatible entry vectorTagsExpressionMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.2
Plasmid#201404PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet-Seq1.1
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-Col1a1/GFP4_Seq1.2
Plasmid#201403PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK3-A
Plasmid#138672PurposeExpresses a mouse SIK3-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK3 mouse (Sik3 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-A
Plasmid#138670PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK2 mouse (Sik2 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK3-C
Plasmid#138674PurposeExpresses a mouse SIK3-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK3 mouse (Sik3 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only