We narrowed to 27,024 results for: CAT
-
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:mTRAAK
Plasmid#224765PurposeIn vitro transcription for Oocyte expression of mTRAAKDepositorInsertPotassium channel subfamily member 4 (Kcnk4 Mouse)
UseIn vitro transcription for oocyte expressionPromoterT7Available SinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
USP7 shRNA-TRE
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp21R
Plasmid#218287PurposeA complete plasmid for ToxAmp (Toxin-antitoxin-driven gene amplification) for the expression of AeBlueDepositorInsertHO(-955, -789)-LoxP>pKlLEU2>KlLEU2>PCRT1>RelB>tPDC1-pTDH3>AeBlue>tSYNth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp12
Plasmid#218286PurposeMulti-copy integration of heterologous genes (AeBlue and RelB) through co-transformation with ToxAmp (toxin-antitoxin-driven gene amplification) modulesDepositorInsertHO(-253, -1)-pCRT1>RelB>tPDC1-pTDH3>AeBlue>tsynth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp1
Plasmid#218285PurposeAmplifying the gene copy number of heterologous genes (yEGFP and RelB) through ToxAmp (toxin-antitoxin-driven gene amplification) mechanismDepositorInsertHO(-253, -1)-pRPL8B>RelB>tPDC1-pTEF1>yEGFP>tURA3-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p11d-RPA70/14 (MSW#134)
Plasmid#208076PurposeExpression of human Replication Protein A 70 and 14-kDa subunits in E. coli with 14 having a His-tagDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_AC-27877
Plasmid#202110PurposeLevel 0 plasmid containing the promoter from gene 27877 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert27877 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_CE-OriT
Plasmid#202150PurposeLevel 0 plasmid containing an origin of transfer sequence from pPtPBR11 required for making plasmids mobilizable for conjugation with CE overhangs used to build level 1 constructs.DepositorInsertOrigin of transfer
UseSynthetic BiologyMutationOriT sequence mutated to remove sapI sites domest…Available SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-Fld
Plasmid#202125PurposeLevel 0 plasmid containing the promoter from gene 23658 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertFld promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-54730
Plasmid#202109PurposeLevel 0 plasmid containing the promoter from gene 54730 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert54730 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-51183
Plasmid#202108PurposeLevel 0 plasmid containing the promoter from gene 51183 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert51183 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-GEF
Plasmid#202107PurposeLevel 0 plasmid containing the promoter from gene 41365 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertGEF promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-47740
Plasmid#202106PurposeLevel 0 plasmid containing the promoter from gene 47740 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert47740 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-BCA
Plasmid#202105PurposeLevel 0 plasmid containing the promoter from gene 51305 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertBCA promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-epyC
Plasmid#202104PurposeLevel 0 plasmid containing the promoter from gene 41316 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertepyC promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_tKiMBImut-T2A-caMEK
Plasmid#199579PurposeExpress tKiMBImut(AA) and caMEK in an AAV vectorDepositorInsertsERK tdTomato-Kinase-Modulated Bioluminescent Indicator (mutant)
constitutively active MEK
UseAAVExpressionMammalianPromoterCMVAvailable SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRA1SEGFPTcIfm
Plasmid#193777PurposeCassette 1: Expresses EGFP under the control of PR promoter, Cassette 2: Expresses frame-shifted CI under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertEGFP and frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyExpressionBacterialPromoterPR promoter and PLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only