We narrowed to 14,985 results for: GRN
-
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Drosha_3
Plasmid#79862PurposeCRISPR/Cas9 DROSHADepositorInsertsgRNA Drosha
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_3
Plasmid#73527PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_4
Plasmid#73528PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for1
Plasmid#81210Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch12_62418577-gRNA-for
Plasmid#81216PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch12 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev2
Plasmid#81207Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev1
Plasmid#81208Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_2
Plasmid#73526PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA_zebrafish_mmp21
Plasmid#72890Purposeplasmid to generate guideRNA against mmp21 gene in zebrafishDepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCC_01 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE
Plasmid#139086PurposeExpresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBR322-sgRNA-pvc18-20-Pdp1_NTD-Cre
Plasmid#243748PurposePVC cargo/regulatory region - deleted toxin cargos (Pdp1/Pnf) - vegfa sgRNA - Cre loaded into the PVC tube via Pdp1 (NTD)DepositorInsertvegfa sgRNA-pvc18-20-Pdp1_NTD-Cre
ExpressionBacterialAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2261 hACTB atgRNA Paired Guide 1
Plasmid#220991PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2262 hACTB atgRNA Paired Guide 2
Plasmid#220992PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
Plasmid#221551PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
Plasmid#185676PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1DepositorInsertERN1 gRNA (ERN1 Human)
UseCRISPRAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSK-mU6-Cj-sgRNA-SV40-puro
Plasmid#192128PurposeExpresses Cj-SgRNA scaffold cloned with BbsI and puromycin resistance geneDepositorInsertCj-SgRNA scaffold
ExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2)_zeo insert c-MYC
Plasmid#164636PurposesgRNA(MS2)_zeo backbone with cloned target sequence for human c-MYC. The insert sequence is: 5-CACCGTTCCCCCACGCCCTCTGCTT-3´ . This sgRNA achieves an upregulation of MYC in combination with dCAS9-VP64DepositorInserttarget sequence for c-Myc activation (MYC Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShCAST(Cas12k-TnsC)-sgRNA_entry (CJT28)
Plasmid#181789PurposeExpresses 3-component ShCAST containing a Cas12k-TnsC fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShTnsB, ShTniQ, ShCas12k-ShTnsC
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only