We narrowed to 27,048 results for: STI
-
Plasmid#11631DepositorAvailable SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only
-
pET28a(+)-SUMO-A'-l4-G'
Plasmid#209124PurposeBacterial expression of CC-GEMS ligand SUMO-A'-l4-G'DepositorInsertSUMO-A'-l4-G'
ExpressionBacterialAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BD-cop1at(335-675)
Plasmid#44973DepositorInsertBD-COP1 (COP1 Mustard Weed)
TagsGAL4 DNA-binding domainExpressionMammalianMutationdeleted amino acids 1-334PromoterpCMVAvailable SinceJune 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
MTK0_017
Plasmid#123932PurposeEncodes the BxBI attB GFP dropout destination vector constitutive NLS::tagBFP as a type 0 part to be used in the MTK systemDepositorInsertBxBI attB tagBFP destination vector
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
p6903 PHAGE-B CMV-N-EGFP Myc
Plasmid#37608DepositorAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
Tol2pA2-drl:APEX2-mCherry
Plasmid#188945PurposePlasmid for Tol2 transgenesis expressing APEX2 tagged to mitochondria and nuclei, and cytoplasmic mCherry, driven by the draculin promoterDepositorInsertdrl:mito-APEX2_p2A_APEX2-H2B_p2A_mCherry_polyA
UseTol2 destination vector (attr4-r3)Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK0_015
Plasmid#123930PurposeEncodes the piggyBac GFP dropout destination vector with the 2xHS4 insulator and constitutive NLS::tagBFP as a type 0 part to be used in the MTK systemDepositorInsertPB Destination - Insulator + tagBFP
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS::PTPRFb-DN-GFP
Plasmid#37111DepositorInsertUAS::PTPRFb-DN-GFP (ptprfb Zebrafish)
UseTol2 gateway expression vectorTagsEGFPMutationDeleted aa1386-1909 corresponding to phosphatase …Promoter10xUASAvailable SinceJuly 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR-v2-Blast-Puro
Plasmid#167186PurposeLentiviral expression of sgRNA with blasticidin and puromycin resistance genesDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgGFP-2
Plasmid#74961PurposeCas9 + sgGFP-2 with blasticidin selectionDepositorInsertGFP
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag 3B/WT myc-M87
Plasmid#87722PurposeExpresses WT myc-M87 spastin isoform in mammalian cellsDepositorInsertSPAST (SPAST Human)
TagsMycExpressionMammalianMutationM87 isoform (deletion of nt 1-490 - 5'UTR an…PromoterCMVAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
delta-EGFP
Plasmid#119223PurposeGABAA receptor expression (delta subunit with EGFP tag at the C-terminus)DepositorAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T merlin 340-595
Plasmid#11634DepositorInsertmerlin (NF2 Human)
TagsGSTExpressionBacterialMutationCarboxy-terminal half of merlin isoform 1.Available SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
FFiBlast MSCV Puro
Plasmid#68464PurposeRetroviral plasmid for establishment of blasticidin resistance Cre-reporter cell lineDepositorInsertBlasticidin Resistance
UseCre/Lox and RetroviralExpressionMammalianMutationInvertedPromoterLTRAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
L2-AA012
Plasmid#185751PurposeVector to introduce eGFP under control of pAaEF1a into the genome of the hornwort Anthoceros agrestis via Agrobacterium mediated transformation. eGFP contains a cell membrane localization tag.DepositorInsertsHygR2
eGFP
Tagsmembrane localization tag Lti6bExpressionPlantAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F1
Plasmid#184163PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 1, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pME-hygro-hPGAP3-3HA
Plasmid#50373PurposeExpress C-terminally triple HA tagged human PGAP3 in mammmalian cellsDepositorInsertPGAP3 post-GPI attachment to proteins 3 (PGAP3 Human)
Tags3x HAExpressionMammalianPromoterSR alphaAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
MPC11 IgG2b gene
Plasmid#127248PurposeExpresses intact IgG2b gene in mammalian cellsDepositorInsertIgG2b gene with exons and alt pAs (Ighg2b Mouse)
ExpressionMammalianAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only