We narrowed to 2,507 results for: EXO
-
Plasmid#182108PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1b) (Mouse). Derived from hybridoma N212A/34.DepositorInsertanti-TRIP8b (exon 1b) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRPL28exon1-(Nhe/Mfe) SpHIS5 (pNTI619)
Plasmid#115432PurposeVector for expressing RPL28 with mutagenized exon2DepositorInsertsUseTagsExpressionYeastMutationexon 2 deleted, with MfeI / NheI cloning sitePromoterAshbya gospii TEF1 and endogenousAvailable sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1a/5) [N291C/22R]
Plasmid#114563PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1a/5) (Mouse). Derived from hybridoma N291C/22.DepositorInsertanti-TRIP8b (exon 1a/5) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
UseTagsExpressionMammalianMutationPromoterdual CMVAvailable sinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 40a
Plasmid#87894Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 40a (DYSF Human)
UseTagsExpressionBacterialMutationalternative isoforms, see commentsPromoterAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 5a, 17, 40a
Plasmid#87895Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 5a, 17, 40a (DYSF Human)
UseTagsExpressionBacterialMutationalternative isoforms, see commentsPromoterAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1a, 40a
Plasmid#87901Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1a, 40a (DYSF Human)
UseTagsExpressionBacterialMutationalternative isoforms, see commentsPromoterAvailable sinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1a, 17, 40a
Plasmid#87899Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1a, 17, 40a (DYSF Human)
UseTagsExpressionBacterialMutationalternative isoforms, see commentsPromoterAvailable sinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 17, 40a
Plasmid#87891Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 17, 40a (DYSF Human)
UseTagsExpressionBacterialMutationalternative isoforms, see commentsPromoterAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 WT minigene
Plasmid#169273PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 WT minigeneDepositorInsertRBM28 Exon1-6 WT minigene (RBM28 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 GT>A minigene
Plasmid#169274PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 GT>A minigeneDepositorInsertRBM28 Exon1-6 GT>A minigene (RBM28 Human)
UseTagsExpressionMammalianMutationNM_018077.2:c.(541+1_541+2delinsA)PromoterCMVAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Kdm1a-exon minimal CMV pCDNA5
Plasmid#212054PurposeLR vector for integration of Kdm1a-exon into N2a FRT rtTA3 expression cellsDepositorInsertKdm1a-exon (Kdm1a Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-Phi29(+exo) (LM2759)
Plasmid#208964PurposeUnfused Phi29 DNA polymerase (+exo), expressed from CMV or T7 promoters.DepositorInsertPhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPromoterCMV and T7Available sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Chtop-exon minimal CMV pCDNA5
Plasmid#212080PurposeLR vector for integration of Chtop-exon into N2a FRT rtTA3 expression cellsDepositorInsertChtop-exon (Chtop Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
tau exon 9–12 FTDP-17 N279K splicing minigene
Plasmid#122967Purposeexpresses circular tau RNAs with the FTDP-17 N279KDepositorInsertmaps
UseTagsExpressionMammalianMutationFTDP-17 mutationPromoterAvailable sinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90)
Plasmid#226989PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1a must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1a to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only