We narrowed to 5,149 results for: mag
-
Plasmid#196219PurposeFluorescent reporter for glutamate, third generation, variant 857 in PDGFR backbone. iGluSnFR3.v857.PDGFRDepositorHas ServiceAAV2InsertpAAV CAG FLEX iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N-D231G
Plasmid#113953Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S, S212N, and …PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLP-FRT.iGluSnFR3.v857.SGZ
Plasmid#196224PurposeFluorescent reporter for glutamate, third generation, variant 857 in SGZ backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV hSyn FLP-FRT iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFGL1344
Plasmid#116902PurposeAlp6:Bar:mCherry (SPB/MTOC marker)DepositorInsertsAlp6 (partial ORF)
Alp6 downstream region
UseFungal expression (in magnaporthe oryzae)Available SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro-HA-PIK3CA(H1047R;G320E)
Plasmid#33254DepositorInsertPIK3CA (PIK3CA Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationchanged histidine 1047 to arginine and glycine 32…PromoterSV40Available SinceJan. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET21-10XHis-GST-HRV-Her2-dL5-Her2
Plasmid#85624PurposeBacterial expression vector for Z342-dL5(E52D)-Z342 affibody fusion protein (AFA) with N-terminal His10, GST and HRV3C cleavage site (MBIC5, dL5**, FAP, AffiFAP)DepositorInsert10XHis-GST-HRV-Her2-dL5-Her2 (EGFR Human, Synthetic, Schistosoma japonicum)
Tags10XHis-GST-HRV and The Her2 Affibody and dL5 FAP …ExpressionBacterialMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterT7Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNCS-mGold2t
Plasmid#231766PurposeExpression of mGold2t in bacterial cellsDepositorInsertmGold2t
ExpressionBacterialMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterSynthetic promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I donor only control (F40-based tension sensor)
Plasmid#119188PurposeThe donor (mTFP1) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration and provides the donor only lifetime to determine FRET efficiency.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP(Y67G)] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I acceptor only control (F40-based tension sensor)
Plasmid#119189PurposeThe acceptor (mEYFP) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration or with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin I-[mTFP1(Y72G)-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBAD-eLACCO2.1
Plasmid#208017PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2.1
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5_CKAR3
Plasmid#238411PurposeMammalian expression of CKAR3 under a CMV promotor.DepositorInsertCKAR3 (PKC sensor)
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL33
Plasmid#227430PurposeKanamycin resistant L5-integrative vector for CRISPR interference in M.tuberculosis with the constitutive expression of mWasabi under the control of the psmyc promotor (psmyc::mWasabi)DepositorInsertmWasabi
UseCRISPRExpressionBacterialAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL34
Plasmid#227431PurposeKanamycin resistant L5-integrative vector for CRISPR interference in M.tuberculosis with the constitutive expression of tdTomato under the control of the psmyc promotor (psmyc::tdTomato)DepositorInserttdTomato
UseCRISPRExpressionBacterialAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-luxKate
Plasmid#229951PurposeMammalian expression of a de novo designed, FRET-based neoLux1.2-mKate2 fusion bioluminescent probe (max. Em=638)DepositorInsertluxKate
ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Multi-frame tag
Plasmid#128610PurposeIn the Multi-frame tag, HIV-1 frameshift sequence is upstream of FLAG epitopes in the 0 frame are separated from one another by SunTag epitopes in the -1 frame.DepositorInsertMF tag
ExpressionMammalianAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Blue_CaMBI
Plasmid#124097PurposeBlue calcium-modulated bioluminescent indicatorDepositorInsertBlue CaMBI
ExpressionMammalianAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNK5712
Plasmid#219752PurposepGAP-like vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnH3H_v2 - tAOX
ExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pABY-T3
Plasmid#201766PurposeFor C-terminal tagging of a protein-of-interest with the ALFA tag using S2/S3 primers in yeastDepositorInsertALFA tag
ExpressionYeastAvailable SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-fMCP
Plasmid#238908PurposeContains EGFP-fMCP fluorogenic proteinDepositorInsertEGFP-fMCP
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAD-luxOFP
Plasmid#229945PurposeBacterial expression of a de novo designed, FRET-based neoLux1.2-CyOFP1 fusion bioluminescent probe (max. Em=588)DepositorInsertluxOFP
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only