We narrowed to 3,268 results for: psin
-
Plasmid#187443PurposeEncodes a specific PSD-95 binder (Xph18) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph18
UseAAVTagseGFPExpressionMammalianPromoterSynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Syn_Xph15_eGFP_CCR5TC
Plasmid#187442PurposeEncodes a specific PSD-95 binder (Xph15) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph15
UseAAVTagseGFPExpressionMammalianPromoterSynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
ExpressionMammalianAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_47-300_mCh-SspB (pBS1071)
Plasmid#185294PurposeFor the mammalian expression of the human protein ApoE3_D125I_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I_47-300
ExpressionMammalianMutationD125IAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_mCh-SspB (pBS1145)
Plasmid#185327PurposeFor the mammalian expression of the human protein ApoE3_D125I attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I
ExpressionMammalianMutationD125IAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_mCh-SspB (pBS1143)
Plasmid#185325PurposeFor the mammalian expression of the human protein ApoE4 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-SspB (pBS1080)
Plasmid#185303PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k5_1_mCh-SspB (pBS1079)
Plasmid#185302PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertPvLEA4_repeats_k5_1
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_10_mCh-SspB (pBS1078)
Plasmid#185301PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_10
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS2_PARRC_98-130_mCh-SspB (pBS1077)
Plasmid#185300PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC_98-130 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC_98-130
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DSUP_RAMVA_1-208_mCh-SspB (pBS1073)
Plasmid#185296PurposeFor the mammalian expression of the tardigrade protein DSUP_RAMVA_1-208 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDSUP_RAMVA_1-208
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHR93_Nccapped_mCh-SspB (pBS1072)
Plasmid#185295PurposeFor the mammalian expression of the synthetic protein DHR93_Nccapped attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDHR93_Nccapped
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_47-300_mCh-SspB (pBS1070)
Plasmid#185293PurposeFor the mammalian expression of the human protein ApoE3_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_47-300_mCh-SspB (pBS1069)
Plasmid#185292PurposeFor the mammalian expression of the human protein ApoE4_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_47-300_mCh-SspB (pBS1068)
Plasmid#185291PurposeFor the mammalian expression of the human protein ApoE2_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE2_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLPS2-CAHS2_PARRC::SspB (pBS1043)
Plasmid#185290PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC
TagsFLAGExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLPS1-FUSN:SspB (pBS1041)
Plasmid#185288PurposeFor the mammalian expression of the human protein FUSN attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertFUSN
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
HT114_Fsyn_FAS(Cre off)_QuasAr6b_Citrine
Plasmid#178825PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6b_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only