We narrowed to 15,273 results for: grn
-
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pScalps eSpCas9_Zsgreen gRNA scaffold
Plasmid#188449PurposeExpression of eSpCas9 tagged with ZsgreenDepositorTypeEmpty backboneUseCRISPR and LentiviralPromoterEF1-alphaAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV U6-sgRNA UbC-GFP
Plasmid#106948PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with GFP markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTZ tRNA_gRNA empty scaffold
Plasmid#188450PurposeExpression of gRNAs using a human tRNA promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromotertRNA glutamineAvailable sinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-SNCA-A53T
Plasmid#181738PurposeTransiently expressing a pegRNA to introduce SNCA-A53T mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A53T (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2A-sgRNA
Plasmid#182551PurposeCas9 from S.pyogenes with 2A-Puro, and the 2A-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2A-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
AeU6 3p3 GFP LgRNA
Plasmid#182208PurposeFor generation of plasmids for CRISPR-mediated 3p3 GFP knockin in Aedes aegyptiDepositorInsert3xP3-GFP
UseCRISPRExpressionInsectPromoterU6Available sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL007-NANOG-sgRNA
Plasmid#175555PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspCas9-nuclease and sgRNA against mouse NANOG STOP Codon
UseMouse TargetingExpressionMammalianAvailable sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Bmpr2ΔKinase gRNA resistant
Plasmid#163411PurposeExpresses BMPR-2ΔKinase resistant to the gRNAs(#163388-90) in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBmpr2 (Bmpr2 Mouse)
ExpressionMammalianMutationThe kinase domain (202-500 aa) is deleted. gRNA-t…Available sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM116: CasRx VEGFA presgRNA
Plasmid#166868PurposeU6-driven expression of human VEGFA targeting presgRNA compatible with CasRx.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHuman VEGFA targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 EMX1-nicking sgRNA
Plasmid#169859PurposeSpyCas9 nicking sgRNA for EMX1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpyCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-Pan-PGC1a sgRNA
Plasmid#165426PurposeExpression of gRNA against human Total PGC-1a variantsDepositorInsertgRNA against human Total PGC-1a variants (PPARGC1A Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBbdCas9S(RBSmut)_Psyn-sgRNAflaB
Plasmid#149588Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAftsI
Plasmid#149590Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAmreB
Plasmid#149594Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Eif4a1-R
Plasmid#122345PurposeExpresses sgRNA targeting mouse Eif4a1 and Cas9 nickase in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA for mouse Eif4a1
ExpressionMammalianAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Dnmt3b-R
Plasmid#122333PurposeExpresses sgRNA targeting mouse Dnmt3b and Cas9 nickase in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA for mouse Dnmt3b
ExpressionMammalianAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only