We narrowed to 18,567 results for: puro
-
Plasmid#192001PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 stable expressing cell line under CMVTRE3G promoterDepositorAvailable sinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pX459-puro-hMYC
Plasmid#185376PurposeFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYCDepositorAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7WT-VA
Plasmid#115182PurposeLentiviral transduction and expression of PARK7WT into any mammalian cellDepositorInsertPARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR 3UTR
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK2
Plasmid#138689PurposeExpresses a human MARK2-targeting sgRNA and Cas9DepositorAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK1
Plasmid#138695PurposeExpresses a human SIK1-targeting sgRNA and Cas9DepositorAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK3
Plasmid#138690PurposeExpresses a human MARK3-targeting sgRNA and Cas9DepositorAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK3
Plasmid#138697PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA-HEK3-Puro
Plasmid#136282PurposeExpresses a guide RNA targeting HEK3 siteDepositorInsertsgRNA-HEK3
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-kLANA-puro
Plasmid#131699Purposeexpresses the KHSV LANA promoter driving puromycin resistanceDepositorPublicationInsertLANA promoter
ExpressionMammalianPromoterLANAAvailable sinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB700-ACTC1-Puro
Plasmid#128324PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (human cells)DepositorInsertgRNA against human ACTC1
ExpressionMammalianAvailable sinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE.puro/TO/Flag/tGFP.HuR.S221D
Plasmid#110351PurposeDoxycycline inducible mammalian retroviral expression of HuR (S221D) with FLAG and turboGFP tagsDepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsFLAG and tGFPExpressionMammalianMutationS221D, P237SPromotergagAvailable sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.TRC1.shmNsd1.2, puro
Plasmid#114447PurposeLentiviral vector for expression of shRNA sequence targeting mouse Nsd1DepositorInsertshNsd1.2 (Nsd1 Mouse)
UseLentiviral and RNAiAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSirenRetroQ(puro)-shEgr4
Plasmid#108117PurposepSIREN-RetroQ vector containing shRNA sequence to Egr4DepositorAvailable sinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX302-PTP-SL-V5 puro
Plasmid#87774PurposeExpresses V5 tagged human PTP-SLDepositorAvailable sinceMarch 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
hPlekhm1_pIRES puro Glue
Plasmid#73453PurposeExpress human Plekhm1 in mammalian cellsDepositorAvailable sinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only