We narrowed to 4,397 results for: GCA
-
Plasmid#64151PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only
-
PX458_NFIA_iso1_2
Plasmid#104049PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_1
Plasmid#104048PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145869)
Plasmid#80256Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_EIF3D_sgRNA_4
Plasmid#74188Purposelentiviral vector expressing sgRNA targeting EIF3DDepositorInsertEIF3D sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_IL1RN
Plasmid#64142PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001144995)
Plasmid#76459Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROCK1 gRNA (BRDN0001146798)
Plasmid#77595Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET20b-delta133HtrA2 A141S
Plasmid#16157DepositorAvailable SinceFeb. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-TGFBR2-m3_3'UTR
Plasmid#31883DepositorInsertTGFBR2 mutant 3'UTR (TGFBR2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationThird miR-302b, 372 7-mer seed match mutated from…PromoterSV40Available SinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B POLE1_1
Plasmid#160763PurposeSuppress POLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMP-DNMT1_2
Plasmid#36383DepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
PTK6 gRNA (BRDN0001149364)
Plasmid#76490Purpose3rd generation lentiviral gRNA plasmid targeting human PTK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pegAAT K342E correction
Plasmid#169841PurposeExpress a pegRNA used for correction (via A•T-to-G•C) of the E342K mutationDepositorInsertpegAAT K342E correction (SERPINA1 Human)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV_mU6-sgNGN3_hU6-sgRNA_hUbC-PuroR-P2A-GFP
Plasmid#162336PurposeLentiviral expression of sgNGN3 paired with a second S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralExpressionMammalianPromoterhU6; mU6Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only