We narrowed to 167,150 results for: Gene
-
Plasmid#19691DepositorInsertPhlh-12
UseGateway entry cloneExpressionWormAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC451
Plasmid#19692DepositorInserthlh-12_coding region
UseGateway entry cloneExpressionWormAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC81
Plasmid#19688DepositorInserthlh-12_genomic region
ExpressionWormAvailable SinceMarch 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC85
Plasmid#19689DepositorInserthlh-12(R15K)_genomic region
ExpressionWormAvailable SinceMarch 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
RCAS(B) En cRaxL deltaC (CC#523)
Plasmid#15196DepositorInsertRaxL
UseRetroviral; Avian expressionAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
RCAS(B) En cRaxL HD (CC#520)
Plasmid#15197DepositorInsertRaxL
UseRetroviral; Avian expressionAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-45: TTN-mEGFP
Plasmid#114412PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TTN, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertTTN Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (TTN Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt âŚAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, IâŚPromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23âŚAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-Puro-mCherry2
Plasmid#219679PurposeCROPseq vector based on #86708 with an additional mCherry2 fluorescent geneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsEF1a-Puro-P2A-mCherry2-WPRE-hU6-gRNAExpressionMammalianAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS-SceI
Plasmid#137725PurposeLentivirus reporter assay plasmid that contains a I-SceI site and a EGFP reporter gene.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hSncg-EGFP
Plasmid#153198PurposeHuman gamma-synuclein (hSncg) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB167 - pL2_pSB90_2x35S::fLUC-I::tNOS_tMAS::rLUC-I::pMAS
Plasmid#123200Purposebinary plant vector for transient expression of a Renilla luciferase (rLUC, with intron) and a firefly luciferase (fLUC, with intron) in plantsDepositorInsert2x35S::fLUC-I::tNOS tMAS::rLUC-I::pMAS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral mBmal1-Luc
Plasmid#182762PurposeLentiviral vector encoding the promoter region of mouse Bmal1 gene driving a luciferase reporterDepositorAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK068.CAG-FRT-stop-FRT-EGFP-ires-tTA-WPRE (Supernova)
Plasmid#85008PurposeFor Flpe/FRT-based Supernova-GFP, pK068 should be used with pK036. The GFP fragment of pK068 can be replaced with another gene by SalI and EcoRV.DepositorInsertEGFP-ires-tTA
ExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pK038.CAG-loxP-stop-loxP-EGFP-ires-tTA-WPRE (Supernova)
Plasmid#85006PurposeFor Cre/loxP-based Supernova-GFP, pK038 should be used with pK031. The GFP fragment of pK038 can be replaced with another gene by using SalI and EcoRV sites.DepositorInsertEGFP-ires-tTA
ExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-HA
Plasmid#61355Purposeencodes c-terminal HA-tagged S. pyogenes dCas9 driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal HA tag
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
iOn-CAGâMCS
Plasmid#154013PurposeExpression vector based on the iOn integration-coupled transcriptional switch (Kumamoto et al bioRxiv 2019), equipped with an MCS to clone-in genes of interest and express it from a CAG promoterDepositorInsertMCS
ExpressionMammalianPromoterCAGAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only