We narrowed to 22,191 results for: his
-
Plasmid#72100PurposeExpresses the extracellular region of the Neuropilin 2, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Jam2-AP-His
Plasmid#71953PurposeExpresses the extracellular region of the JAM-2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSF_6His-ZmSUMO1a-GG
Plasmid#91929PurposeBacterial expression of maize SUMO1aDepositorInsert6His-ZmSUMO1a-GG
UseTags6HisExpressionBacterialMutationTruncation of ZmSUMO1a after the diGlycine motifPromoterAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.4-Fc-His
Plasmid#72101PurposeExpresses the extracellular region of the Neuropilin 2, isoform 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Islr2.b-Fc-His
Plasmid#72077PurposeExpresses the extracellular region of the Islr2.b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Islr2.b-AP-His
Plasmid#71951PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-Fc-His
Plasmid#72081PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.c-AP-His
Plasmid#71965PurposeExpresses the extracellular region of the Neogenin 1, isoform c protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb2(L)-AP-His
Plasmid#72002PurposeExpresses the extracellular region of the PlexinB2 protein (ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnc1-AP-His
Plasmid#72005PurposeExpresses the extracellular region of the PlexinC1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Unc5c.z-Fc-His
Plasmid#72182PurposeExpresses the extracellular region of the Unc5C, isoform z protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.c-Fc-His
Plasmid#72112PurposeExpresses the extracellular region of the Netrin G1, isoform c protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sdk2-AP-His
Plasmid#72009PurposeExpresses the extracellular region of the Sdk2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc2-FLAGHISNDHFR
Plasmid#63965PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneUseTags6xHis & FLAG; TEV cleavableExpressionBacterialMutationPromoterT7Available SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-AP-His
Plasmid#72004PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Unc5d.z-Fc-His
Plasmid#72185PurposeExpresses the extracellular region of the Unc5D, isoform z protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
unc5bCD4d3+4-His
Plasmid#36151PurposeEXPRESs plasmid for Zebrafish Receptors encoding zebrafish unc5b (netrin-1a) with rat CD4d3+4-His tagDepositorInsertunc5b (unc5b Zebrafish)
UseTagsHis tag and ratCD4d3+4ExpressionMammalianMutationL2VPromoterCMVAvailable SinceMay 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIS-Hsv2
Plasmid#42524DepositorInsertHsv2
UseTagsHIS-TEVExpressionBacterialMutationPromoterAvailable SinceJuly 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTrcHIS2-MtFAAH1
Plasmid#243679PurposeExpresses Medicago truncatula FAAH1 isoform in E. coli.DepositorInsertMedicago truncatula Fatty Acid Amide Hydrolase 1
UseTagsc-myc, 6xHISExpressionBacterialMutationPromotertrcAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTrcHIS2-MtFAAH2a
Plasmid#243680PurposeExpresses Medicago truncatula FAAH2a isoform in E. coli.DepositorInsertMedicago truncatula Fatty Acid Amide Hydrolase 2a
UseTagsc-myc, 6xHISExpressionBacterialMutationPromotertrcAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS26_10xHis_MBP_TEV_VRER-Cas9
Plasmid#244829PurposeBacterial expression of VRER Cas9 for protein purificationDepositorInsertVRER Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD1135V/G1218R/R1335E/T1337RPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS16_10xHis_MBP_TEV_xPBA-Cas9
Plasmid#244830PurposeBacterial expression of xPBA Cas9 for protein purificationDepositorInsertxPBA Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS71_10xHis_MBP_TEV_WT-Cas9_2xNLS
Plasmid#244833PurposeBacterial expression of SpyCas9 (WT) with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpyCas9 (WT)
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialMutationPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS23_10xHis_MBP_TEV_SpG-Cas9
Plasmid#244826PurposeBacterial expression of SpG Cas9 for protein purificationDepositorInsertSpG Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS1_10xHis_MBP_TEV_WT-Cas9
Plasmid#244825PurposeBacterial expression of SpyCas9 (WT) for protein purificationDepositorInsertSpyCas9 (WT)
UseCRISPRTags10xHis-MBPExpressionBacterialMutationPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS24_10xHis_MBP_TEV_SpRY-Cas9
Plasmid#244827PurposeBacterial expression of SpRY Cas9 for protein purificationDepositorInsertSpRY Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationA61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS25_10xHis_MBP_TEV_EQR-Cas9
Plasmid#244828PurposeBacterial expression of EQR Cas9 for protein purificationDepositorInsertEQR Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD1135E/R1335Q/T1337RPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS73_10xHis_MBP_TEV_SpRY-Cas9_2xNLS
Plasmid#244835PurposeBacterial expression of SpRY Cas9 with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpRY Cas9
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialMutationA61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS72_10xHis_MBP_TEV_SpG-Cas9_2xNLS
Plasmid#244834PurposeBacterial expression of SpG Cas9 with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpG Cas9
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialMutationD1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
NLuc-His10
Plasmid#234567PurposeBacterially expressed NLuc for Ni-NTA purificationDepositorInsertNano luciferase
UseTagsT7 gene 10 leader peptide and Thrombin site-10xHi…ExpressionBacterialMutationCodon optimized for bacterial expressionPromoterT7Available SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a:His-RWT4Ca
Plasmid#237519PurposeRecombinant protein expressionDepositorInsertRwt4Ca
UseTagsExpressionBacterialMutationPromoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a:His-MBP-KD
Plasmid#237520PurposeRecombinant protein expressionDepositorInsertRwt4_kinase
UseTagsExpressionBacterialMutationKinase region of RWT4PromoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET15bHis6-pG-Tnp
Plasmid#124884PurposeTo transform BL21-Gold(DE3) and induced by IPTG for His-proteinG-Tnp (hyperactive mutant) fusion protein.DepositorInsertprotein G's C1D1C2D2C3 domains contained in the protein G gBLOCK.
UseTagsExpressionBacterialMutationPromoterT7Available SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET15bHis6-pG-MNase
Plasmid#124886PurposeTo transform BL21-Gold(DE3) and be induced by IPTG for His-proteinG-MNase fusion protein expression.DepositorInsertprotein G-MNase
UseTagsExpressionBacterialMutationPromoterT7Available SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-443_Cacnes_HisB
Plasmid#225608PurposeSuicide C. acnes vector to generate HisB (PPA_RS05815) deletion leaving an Ery resistance cassette flanked by BxbI recombination sitesDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL7_2xNLS_iGeoCas9(C2)_2xNLS_His
Plasmid#222988PurposeBacterial expression of iGeoCas9(C2) constructDepositorInsertCL7_2xNLS_iGeoCas9(C2)_2xNLS_His
UseCRISPRTagsCL7 and HisExpressionBacterialMutationPromotertacAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSF_his6_sumo_SARS_CoV2_NSP14_D90A/E92A
Plasmid#213527PurposeExpresses NSP14 of SARS-CoV-2 with two point mutations D90A and E92ADepositorInsertNSP14 of SARS-CoV-2 (ORF1ab SARS-CoV-2)
UseTagsHis6-sumoExpressionBacterialMutationD90A and E92APromoterAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDF-His_TEV_MsbA
Plasmid#191476PurposeExpresses MsbA with a TEV protease cleavable N terminal His TagDepositorInsertMsbA
UseTagsHisExpressionBacterialMutationPromoterT7Available SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only