We narrowed to 4,648 results for: TIL
-
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pOCC120
Plasmid#118892Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal MBP tag, cleavable with 3C, and C-terminal monomeric GFP and HIS6, cleavable with TEVDepositorInsertNcoI-MBP-3C-NotI-ccdB-AscI-mGFP-3C-HIS6-stop-HindIII cassette
TagsMBP, cleavable with 3C protease and mGFP, HIS6, c…ExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40 CreERT2 L3-L2
Plasmid#62174PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and CreERT2 module. Compatible with MultiSite Gateway cloningDepositorInsertCreERT2
UseMule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-POLArISact
Plasmid#164970PurposeT7 promotor drives in vitro transcription of POLArISact with a human kozak sequenceDepositorInsertPOLArISact
UseIn vitro transcriptionPromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold R4-R3
Plasmid#62131PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pH-eCFP
Plasmid#176555PurposeExpression of eCFP for auxotrophic selection in the absence of histidineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-eCFP
Plasmid#176556PurposeExpression of eCFP for auxotrophic selection in the absence of leucineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU-eCFP
Plasmid#176557PurposeExpression of eCFP for auxotrophic selection in the absence of uracilDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
RET_KD-V5
Plasmid#139628PurposeV5-His-tagged gene expressionDepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV LacZ L5-L2
Plasmid#62166PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and LacZ module. Compatible with MultiSite Gateway cloningDepositorInsertLacZ
UseMule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-Ngn1
Plasmid#118589PurposeExpresses Ngn1 from the TRE3G promoterDepositorAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU-mRuby2
Plasmid#176549PurposeExpression of mRuby2 for auxotrophic selection in the absence of uracilDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-mRuby2
Plasmid#176547PurposeExpression of mRuby2 for auxotrophic selection in the absence of histidineDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40 mCherry L3-L2
Plasmid#62150PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and mCherry module. Compatible with MultiSite Gateway cloningDepositorInsertmCherry
UseMule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L1-L4
Plasmid#62128PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-KB-1753-Nluc I9A/W10A
Plasmid#158604PurposePlasmid expressing KB-1753-Nluc I9A/W10A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker(GIKLGG) - KB1753 I9A/W10A - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-mas-GRK2RH-Nluc L118A
Plasmid#158606PurposePlasmid expressing GRK2(RH)-Nluc L118A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker (GIKLGG) - GRK2 RH domain L118A - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_C433S-GFP fusion
Plasmid#139638PurposeGFP-tagged gene expressionDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_C723S-GFP fusion
Plasmid#139639PurposeGFP-tagged gene expressionDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only