We narrowed to 7,376 results for: ESP
-
Plasmid#215331PurposeExpression monoclonal antibody 131-2a LCDepositorInsert131-2a_LC
ExpressionMammalianPromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F2
Plasmid#184164PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 2, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PclpB GFP pZa
Plasmid#170074PurposeGFP expression under the control of E. coli clpB promoterDepositorInsertGreen fluorescent protein
ExpressionBacterialPromoterPclpBAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSDH5_G78R
Plasmid#113047PurposeExpression of mutant hSDH5DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Flag-RagC(L91P)
Plasmid#99726PurposeMammalian expression of Flag-RagC(L91P)DepositorAvailable SinceNov. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Flag-RagC(K84T)
Plasmid#99727PurposeMammalian expression of Flag-RagC(K84T)DepositorAvailable SinceNov. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSETB-roGFP1-R7
Plasmid#83309PurposeInducible expression of redox sensitive GFP in bacteriaDepositorInsertroGFP1-R7
Tags6xHISExpressionBacterialMutationC48S/Q80R/S147C/Q204C/F223R/S202KAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E054 Hs.EGFR-nostop
Plasmid#70338PurposeGateway ORF clone of human EGFR [NM_005228.3] without stop codon (for C-terminal fusions)DepositorInsertEGFR (EGFR Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E031 Hs.CYTH2
Plasmid#70315PurposeGateway ORF clone of human CYTH2 [NM_017457.5] with stop codon (for native or N-terminal fusions)DepositorInsertCYTH2 (CYTH2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-SS-127
Plasmid#68733PurposeZF5-TF with mCherry markerDepositorInsertsZF5-VP64
mCherry
TagsNLS and flagExpressionMammalianAvailable SinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTM-RBDv2
Plasmid#162785PurposeSARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cellsDepositorInsertSARS-CoV-2 S protein receptor binding domain (RBD) (S Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2))
Tags10xHis, c-myc, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGal4x5-E4T-G210
Plasmid#171077PurposeThe resulting plasmid was used to generate a Gal4x5-E4-Gless 210bp construct for ampilifying the immobilized template for assays. Originally came from Michael Carey, was submitted with his permissionDepositorInsertGal4-E4-Gless-cassette
ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1032
Plasmid#217962PurposeMammalian expression of NASP ('s' isofrom) fused at its N-terminus to eGFP with a TEV protease site separating the two. Puromycin resistance is expressed from a downstream IRES.DepositorAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
131-2a_HC
Plasmid#214965PurposeExpression monoclonal antibody 131-2aDepositorInsert131-2a_HC
Tagshis8ExpressionMammalianPromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-loxP-GRAB_DA2m-loxP
Plasmid#189751PurposeExcludes sensor expression in Cre-positive neuronsDepositorInsertDopamine sensor GRAB_DA2m
UseAAVPromoterEF1aAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJPF0117
Plasmid#130267PurposeLentiviral vector for the co-expression of cytoplasmic bPAC and nuclear tagBFPDepositorInsertbPAC
UseLentiviralTagstagBFPExpressionMammalianPromoterhPGKAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_C_Myc_DDK_IRES_Puro_UFD1L
Plasmid#106118PurposeLentiviral expression of UFD1LDepositorAvailable SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL2
Plasmid#106107PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL2DepositorInsertgRNA targeting ELAVL2 (ELAVL2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only