We narrowed to 8,573 results for: reporter
-
Plasmid#63893PurposeLuciferase reporter of mouse wildtype Nanog 3'UTRDepositorInsertNanog homeobox (Nanog Mouse)
ExpressionMammalianAvailable SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-99a
Plasmid#169304PurposeConstitutive overexpression of miR-99a with GFP as a reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2043
Plasmid#79651PurposessAAV genome with Ple254 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple254-EmGFP WPRE
UseAAVPromoterPAX6 Retinal EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT
Plasmid#89890PurposeBAC donor construct containing 3XHA-tagged BirA, a ribosome skipping motif - 2A, Citrine reporter, polyadenyation signal, followed by FRT recombination sites flanking kanamycin selection cassette.DepositorInsertHA-BirA-2A-citrine
UseUnspecifiedTagsCitrineAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMini-CAAGs::RFP-DR48
Plasmid#132640PurposeFluorescent reporter to quantify elicitation of the strand annealing mediated repair pathwayDepositorInsertmRFP
ExpressionMammalianMutationContains a 92bp insertion interrupting the open …PromoterChicken B-actinAvailable SinceNov. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMiR-E6AP-3'UTR-miR-375-mut
Plasmid#53695PurposeLuciferase reporter assay for E6AP 3'UTR with point mutation on miR-375 binding siteDepositorInsertUBE3A 3'UTR (UBE3A Human)
UseLuciferaseMutationMutation on miR-375 binding site on E6AP 3'U…Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
exon L-firefly
Plasmid#81006Purposeluciferase based mini-gene to report splicing at exon 25 in Drosophila paraylticDepositorInsertparalytic (para Fly)
Tagsfirefly luciferaseExpressionInsectMutationspanning exon 24 to exon 26, termination codon in…PromoterP-AC5 (Actin 5C)Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3A2-mCherry
Plasmid#73425PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3A2.DepositorInsertPromoter 3A2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3A2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROZA-XL YF
Plasmid#64195PurposeFluorescent reporter for ZAP-70 tyrosine kinase activity- Y to F mutated control sequenceDepositorInsertROZA-XL YF
ExpressionMammalianMutationROZA-XL tyrosine phosphorylation site mutated to …PromoterCMVAvailable SinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIneoRL-KLF9 3'UTR
Plasmid#84599PurposeRenilla luciferase reporter containing KLF9 3'UTRDepositorAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_CMV
Plasmid#99313PurposeLuciferase validation vector with CMV enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertCMV enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-5F5-mCherry
Plasmid#73422PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 5F5.DepositorInsertPromoter 5F5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP5F5 (orthogonal T7-lac variant)Available SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIS1-mutant RhoA 3'UTR
Plasmid#26090DepositorInsertmutant RhoA 3'UTR (RHOA Human)
UseLuciferaseExpressionMammalianMutationBoth miR-31 binding sites in 3’ UTR mutagenized. …Available SinceOct. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
2.3 hA33 luciferase
Plasmid#68148Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -2270 relative to ATGPromoterhuman GPA33 promoterAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
Luc-Nanog-3'UTRmut
Plasmid#63894PurposeLuciferase reporter of mouse Nanog 3'UTR with the miR-34 target site mutatedDepositorInsertNanog homeobox (Nanog Mouse)
ExpressionMammalianAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
c-JUN partial 3'UTR (WT) in pmiRGLO Dual-Luciferase
Plasmid#254391PurposeExpress luciferase reporter containing partial human c-JUN 3'UTR (wild type)DepositorInsertc-JUN partial 3'UTR
UseLuciferaseExpressionMammalianPromoterPGKAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
c-JUN partial 3'UTR (mut) in pmiRGLO Dual-Luciferase
Plasmid#254392PurposeExpress luciferase reporter containing partial human c-JUN 3'UTR mutant (with the predicted miR-513a-5p binding site deleted)DepositorInsertc-JUN partial 3'UTR
UseLuciferaseExpressionMammalianMutationpredicted miR-513a-5p binding site deletedPromoterPGKAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
huCofilin K22Q SSR-mRFP
Plasmid#252617PurposeExpresses shRNA resistant human cofilin with K22Q mutation that reduces nuclear uptake and serves as a cofilactin rod reporterDepositorInsertcofilin 1 (CFL1 Human)
TagsmRFPExpressionMammalianMutationK22Q; silent mutations at nt 67 to 75 in which TC…PromoterCMVAvailable SinceMarch 5, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti X1 Puro 8xGLI_minPro_Luc2p_Ren
Plasmid#249282PurposeDual-luciferase GLI reporter viral plasmid. 8xGLI binding site followed by minPro-luc2P expression, in addition to constitutive SV-40-driven Renilla luciferase expression.DepositorInsertLuciferase
UseLentiviralAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-GFP-WPRE-miR124T
Plasmid#245069PurposeFluorescent reporter gene with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertEGFP, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-YB_TATA)-Halo-p53-BGH_pKG2745
Plasmid#246339Purpose203-bp DIAL Reporter Plasmid with YB_TATA expressing Halo-p53 in the presence of ZFa and editable by Cre recombinaseDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-Lifeact-mRuby2-3xMyc (JDW 1246)
Plasmid#242554PurposeGateway middle entry clone containing Lifeact-mRuby2-3xMyc; Red F-actin reporterDepositorInsertmRuby2
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA](pAVA3000)
Plasmid#239349PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of C8351G MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA
ExpressionMammalianMutationMALAT1 ENE(C8351G)Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mStayGold-WPRE (JDW 1384)
Plasmid#242550PurposeGateway middle entry clone containing H2B-mStayGold with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmStayGold (monomeric StayGold)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mBaoJin-WPRE (JDW 1383)
Plasmid#242549PurposeGateway middle entry clone containing H2B-mBaoJin with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmBaoJin
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mScarlet-3H (JDW 1513)
Plasmid#242551PurposeGateway middle entry clone containing H2B-mScarlet-3H; Nuclear red fluorescent reporterDepositorInsertmScarlet3-H
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-mCerulean3-TUBB1A (JDW 1508)
Plasmid#242555PurposeGateway middle entry clone containing mCerulean3-TUBB1A; Cyan fluorescent reporter for visualizing tubulin in cellsDepositorInsertmCerulean3-TUBB1A
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO(R285A)-NES
Plasmid#238919PurposeMammalian expression of mutated DAAO(R285A) with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO(R285A)-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(C8351G)-mascRNA](pAVA2995)
Plasmid#239350PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of C8351G MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA
ExpressionMammalianMutationMALAT1 ENE(C8351G)Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(WT)-mascRNA](pAVA2987)
Plasmid#239348PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD1112 TRE-mCherry-SKL-22Xm6A MS2
Plasmid#235128PurposemCherry reporter plasmid for live cell visualization of RNA m6A modificationDepositorInsertTRE-mCherry-SKL-22Xm6A MS2
UseLentiviralExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2783 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-16 CMV-BFP
Plasmid#240513PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-16 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2784 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-20a CMV-BFP
Plasmid#240514PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-20 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2785 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-125a CMV-BFP
Plasmid#240515PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-125a Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2786 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-151a CMV-BFP
Plasmid#240516PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-151a Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2787 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-221 CMV-BFP
Plasmid#240517PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-221 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO(R285A)-NES
Plasmid#238921PurposeExpression of mutated DAAO(R285A) with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO(R285A)-NES
UseAAVExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUN1307 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pT3R
Plasmid#203899PurposeReporter plasmid for the T3R promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpT3R-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUN1308 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pNMT
Plasmid#203900PurposeReporter plasmid for the NMT promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpNMT-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUN1310 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pDAT
Plasmid#203902PurposeReporter plasmid for the DAT promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpDAT-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSB284 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pT16H2
Plasmid#203896PurposeReporter plasmid for the T16H2 promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpT16H2-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUN1305 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-p16OMT
Plasmid#203897PurposeReporter plasmid for the 16OMT promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertp16OMT-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUN1306 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pT3O
Plasmid#203898PurposeReporter plasmid for the T3O promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpT3O-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS1354 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-1 CMV-BFP
Plasmid#226113PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-1-5p Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS1355 CMV-AcrIIC3-FLAGNLS-mCherry CMV-BFP
Plasmid#226114PurposeMammalian expression of AcrIIC3-mCherry fusion without microRNA target sites in the 3' UTR as a control reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS1386 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-107 CMV-BFP
Plasmid#226115PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-107 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS1350 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-92a CMV-BFP
Plasmid#226109PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-92a Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only