We narrowed to 9,464 results for: CAG
-
Plasmid#85932PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-SSA. Puro-T2A-EGFP
UseDual-reporter surrogateExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p55-H2B-Dendra2
Plasmid#80609PurposeEncodes H2B-Dendra2-fusion protein under the CAG promoter. Linearize using Asc1 and Not1 for mouse embryo injection.DepositorAvailable SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNHEJ-RPG
Plasmid#85931PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-NHEJ. Puro-T2A-EGFP
UseDual-reporter surrogateExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPPH-T2A-GFP-shP53
Plasmid#102897PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPPH-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPP300-T2A-GFP-shP53
Plasmid#102896PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPP300-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAB-HDAC5(mut-H-Y)
Plasmid#114398PurposeFor PYL-HDAC5 H1006Y expressionDepositorInsertPYL-HDAC5 H1006Y
ExpressionMammalianMutationadditional D593E compared to NCBI ref NP_005465.2PromoterCMVAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-PYL-HDAC5-NEO)
Plasmid#114395PurposeFor PYL-HDAC5 expressionDepositorInsertPYL-HDAC5
Tags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared with NCBI reference NP_005465.2PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-HDAC5(mut-H-A)
Plasmid#114397PurposeFor PYL-HDAC5 H1006A expressionDepositorInsertPYL-HDAC5 H1006A
Tags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared to NCBI ref NP_005465.2PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-EXPR(PYL-cat_dom_HDAC5)
Plasmid#114401PurposeFor PYL-HDAC5 catalytic domain expressionDepositorInsertPYL-HDAC5 catalytic domain
Tags3xFlag-NLS (internal)ExpressionMammalianMutationS220F and the deletion of M221PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-EXPR(PYL-Nterm_dom_HDAC5)
Plasmid#114402PurposeFor PYL-HDAC5 N terminal domain expressionDepositorInsertPYL-HDAC5 N terminal domain
Tags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared to NCBI ref NP_005465.2PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_GFP
Plasmid#134843PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A EGFPExpressionMammalianPromoterCAGAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_mCherry
Plasmid#134844PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A mCherryExpressionMammalianPromoterCAGAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_Puro
Plasmid#134845PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A PuromycinExpressionMammalianPromoterCAGAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRT029
Plasmid#127969Purposedouble-DHFR-degron controlled expression of dCas9-BFP-KRAB from the CLYBL locusDepositorInsertCLYBL-CAG-DHFR-dCas9-BFP-KRAB-DHFR
UseTALENExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRT043-CLYBL-DDdcas9-VPH
Plasmid#158091PurposeInducible expression of dCas9-VPH from the CLYBL locus for CRISPR activationDepositorInsertCLYBL-CAG-DDdCas9VPH-T2A-GFP
UseTALENExpressionMammalianPromoterCAGAvailable SinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
mouse b8 full length
Plasmid#217817PurposeFull length mouse integrin b8 expressionDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only