We narrowed to 9,432 results for: tre promoter
-
Plasmid#65379PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only
-
GFP-BRD9
Plasmid#65380PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Full length Importin beta
Plasmid#106941PurposeTransient expression of GFP-tagged Importin beta in mammalian cells (CMV promoter)DepositorInserthuman Importin beta-1 (KPNB1) (KPNB1 Human)
TagsGFPExpressionMammalianPromoterCMV promoterAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX307 HRAS
Plasmid#117748PurposeOpen reading frame vector encoding HRASDepositorInsertRASH1 (HRAS Human)
UseLentiviralTagsV5ExpressionMammalianMutationClosed vector so will not read through the V5 reg…PromoterEF1aAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF1-V1-FLAG-IRES-GFP
Plasmid#107387PurposeLentiviral expression of IKZF1-V1-FLAGDepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1B
Plasmid#65372PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ2A
Plasmid#65373PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-KLC1
Plasmid#166964PurposeExpresses Myc-tagged KLC1 protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-HA-Nr4a1
Plasmid#160941PurposeGeneration of retrovirus for the overexpression of Nr4a1DepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD1
Plasmid#65375PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRPF1
Plasmid#65382PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
HA-KIF5A
Plasmid#166958PurposeExpresses HA-tagged KIF5A protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/FLAG/HA-HDLBP
Plasmid#154450PurposeExpression of FLAG/HA-tagged HDLBPDepositorInsertHDLBP (HDLBP Human)
ExpressionMammalianAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-CECR2
Plasmid#65385PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTET2 CD mutant
Plasmid#89896PurposeExpresses mouse TET2 CD mutant in mammalian cellsDepositorInsertTET2 (Tet2 Mouse)
TagsFlagExpressionMammalianMutationCD (cysteine-rich, dioxygenase domain) truncation…Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xA
Plasmid#92007PurposeExpresses FLAG-HA-AGO2 [S824A, S828A, T830A, S831A, S834A (5xA)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824A, S828A, T830A, S831A, S834A (5xA)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX301-ARF6-TagRFP
Plasmid#162029PurposeExpression of tagged ARF WTDepositorInsertARF6 (ARF6 Human)
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xE
Plasmid#92008PurposeExpresses FLAG-HA-AGO2 [S824E, S828E, T830E, S831E, S834E (5xE)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824E, S828E, T830E, S831E, S834E (5xE)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRPF3
Plasmid#65383PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only