We narrowed to 10,252 results for: tre promoter
-
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2K7bsdUBI-mCherry-STIM1
Plasmid#114178PurposeLentiviral vector for expression of mCherry-STIM1DepositorInsertSTIM1 (STIM1 Human)
UseLentiviralTagsmCherry (inserted after signal peptide)ExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRIGF-IKZF1-V2
Plasmid#69045Purposeexpression of IKZF1 fused to firefly luciferase with co-expression of Renilla luciferase, both under IRES control.DepositorInsertIKZF1 (IKZF1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationsplice variant 2PromoterIRESAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A Δ450-572-pBabe-Puro
Plasmid#25958DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceSept. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCR-XL-rAkap9
Plasmid#196867PurposeCloned rat (r) A-Kinase Anchoring Protein 9 (Akap9) ORF. Used as a template for Akap9 containing constructsDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A/P531A/N847A-pBabe-Puro
Plasmid#25956DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceOct. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A/P531A/N847Q-pBabe-Puro
Plasmid#25948DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceSept. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
MSCV-HA-Nr4a1-AA
Plasmid#160942PurposeGeneration of retrovirus for the overexpression of Nr4a1 mutant (287C 288EAA)DepositorInsertNr4a1 (Nr4a1 Mouse)
UseRetroviralTagsHA tagExpressionMammalianMutationChange Cys 287 Glu 288 into Ala AlaPromoterMSCV-LTRAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 / alpha5 pcDNA1 neo
Plasmid#13588DepositorInsertintegrin alpha 9 / alpha 5 (ITGA9 Human)
ExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR
Plasmid#62575PurposeTranslational Luciferase Reporter containing a 926 bp fragment of the RASA1 3'UTR.DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
flag-hKLF6 P149S (1008)
Plasmid#49496Purposeexpresses human Flag tagged KLF6 with P149S mutationDepositorAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 / alpha4 pcDNA1 neo
Plasmid#13587DepositorInsertintegrin alpha 9 / alpha 4 (ITGA9 Human)
ExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 / alpha2 pcDNA1 neo
Plasmid#13586DepositorInsertintegrin alpha 9 / alpha 2 (ITGA9 Human)
ExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344A
Plasmid#34601DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206B
Plasmid#34600DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG2744
Plasmid#246340Purpose203-bp DIAL Reporter Plasmid with YB_TATA expressing mCherry-GS-HRasG12V in the presence of ZFa and editable by Cre recombinaseDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
SB-CAG-mCherry-P2A-EIF3D-DD-IP
Plasmid#236770PurposeA sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D S528D/S529D-IRES-Pac.DepositorInsertEIF3D (EIF3D Human)
UseSleeping beautyExpressionMammalianMutationchanged Serine 528 to Aspartic Acid and Serine 52…PromoterCAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 PTEN C124S
Plasmid#237340Purposetransient overexpression in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
SB-CAG-mCherry-P2A-EIF3D-NN-IP
Plasmid#236771PurposeA sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D S528N/S529N-IRES-Pac.DepositorInsertEIF3D (EIF3D Human)
UseSleeping beautyExpressionMammalianMutationchanged Serine 528 to Asparagine and Serine 529 t…PromoterCAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only