We narrowed to 2,360 results for: EFS
-
-
-
-
-
-
-
-
-
-
-
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorInsertAICD (APP Human)
UseAAVTagsExpressionMutationNonePromoterhuman synapsinAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
FcD265A-IL2
Plasmid#65419PurposeMammalian expression plasmid for murine serum-persistent IL-2DepositorInsertFcD265A-IL2 (Il2 Mouse)
UseTagsHisExpressionMammalianMutationD265APromoterModified CMV PromoterAvailable sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
plenti-As-Cas12a-2xNLS
Plasmid#155047PurposeLentiviral vector expressing human codon-optimized _C-terminal Myc-tagged _Acidaminococcus sp. BV3L6 (As)-Cas12a nuclease with N- and C-terminal NLS and Neomycin/G418/Geneticin resistance from EF-1alpha promoterDepositorInsertAsCas12a
UseCRISPR and LentiviralTagsNucleoplasmin NLS, Myc-tag and SV40 NLSExpressionMammalianMutationPromoterEF-1aAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
VARP GFP-pLXIN
Plasmid#62950Purposefull length human VARP with C-terminal EGFP tag cloned into pLXINDepositorInsertVARP (ANKRD27 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationsilent mutations of amino acids 422-428 to produc…PromoterLTRAvailable sinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP HAT
Plasmid#179547Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ENL)
Plasmid#69212PurposeLentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; MLL-ENL,(t[11;19])DepositorInsertsUseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1+FLAG-KrascomQ61R
Plasmid#206845PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a Q61R mutation with an N-terminal FLAG tag.DepositorInsertKras (Kras Mouse)
UseTagsFLAGExpressionMammalianMutationCodons altered to most optimum based on mouse cod…PromoterAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 PHD-HAT
Plasmid#179545Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP PHD-HAT
Plasmid#179548Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-