-
Plasmid#179551Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human GCN5 core (aa 473-676) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human GCN5 core (aa 473-676) (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1+FLAG-KrascomQ61R
Plasmid#206845PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a Q61R mutation with an N-terminal FLAG tag.DepositorInsertKras (Kras Mouse)
UseTagsFLAGExpressionMammalianMutationCodons altered to most optimum based on mouse cod…PromoterAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 PHD-HAT
Plasmid#179545Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP PHD-HAT
Plasmid#179548Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
LentiCRISPRv2-mCherry
Plasmid#99154PurposeLentiviral vector encoding sgRNA cloning site + hSpCAS9-P2A-mCherry.DepositorInsertsCas9
mCherry
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterEFS-NSAvailable sinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
p404TEF1
Plasmid#15972DepositorInsertTEF1 promoter + polylinker + CYC1 terminator (TEF1 Budding Yeast)
UseTagsExpressionBacterial and YeastMutationTEF1 promoter is between SacI and XbaI restrictio…PromoterAvailable sinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
p406TEF1
Plasmid#15976DepositorInsertTEF1 promoter + polylinker + CYC1 terminator (TEF1 Budding Yeast)
UseTagsExpressionBacterial and YeastMutationTEF1 promoter is between SacI and XbaI restrictio…PromoterAvailable sinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only