We narrowed to 4,784 results for: AAT
-
Plasmid#107355PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 sfGFP trigger is co-expressedDepositorInserttoehold 7 + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDNR-gRNA
Plasmid#206990PurposeA plasmid for expression of SaCas9-sgRNA targeting donor plasmidsDepositorInsertDonor plasmid-targeting SaCas9-gRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVDM1001
Plasmid#134660PurposeCRISPR delivery and repair template delivery vectorDepositorInsertCRISPR guide RNA array
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorInsertmiRaSynuclein(human) (SNCA Human)
UseAAV and RNAiTagsExpressionMutationPromoterCAGAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCOLA banana sensor sfGFP
Plasmid#107367PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when exposed to extracted and RPA-amplified banana DNADepositorInsertbanana-detecting toehold + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLSE-shREN
Plasmid#105583Purposeretrovirally express control shRNA with GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterMSCV-LTRAvailable sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1 BSMT1
Plasmid#106287PurposeExpresses BSMT1 in Ecoli off a T7 promoterDepositorInsertBSMT1
UseTagsExpressionBacterialMutationPromoterT7Available sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A2NT
Plasmid#62257Purposeexpression of A2NT sgRNA from the arabinose-inducible promoterDepositorInsertA2NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCOLA kiwi sensor sfGFP
Plasmid#107368PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when exposed to extracted and RPA-amplified kiwi DNADepositorInsertkiwi-detecting toehold + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCol-TGM-luc.1309
Plasmid#32720DepositorInsertluciferase
UseMouse Targeting and RNAiTagsExpressionMutationPromoterTRE and TreAvailable sinceMarch 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNP1 OR sfGFP
Plasmid#107364PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 OR input A and pNP1 OR input B are co-expressedDepositorInsertOR gate + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNL1 Ecarin
Plasmid#106289PurposeExpresses Ecarin in Ecoli off a T7 promoter in the NEB control cloning vectorDepositorInsertEcarin
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNP1 AND gate sfGFP
Plasmid#107361PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 AND input A and pNP1 AND input B are co-expressedDepositorInsertAND gate + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6-miR.FF4
Plasmid#235256PurposeNon-intronic (U6-driven) expression of miR-FF4 (FF4 hairpin)DepositorInsertFF4 hairpin
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterU6Available sinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210747PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210748PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only