We narrowed to 2,745 results for: EXO
-
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRPL28exon1-(Nhe/Mfe) SpHIS5 (pNTI619)
Plasmid#115432PurposeVector for expressing RPL28 with mutagenized exon2DepositorInsertsExpressionYeastMutationexon 2 deleted, with MfeI / NheI cloning sitePromoterAshbya gospii TEF1 and endogenousAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1a/5) [N291C/22R]
Plasmid#114563PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1a/5) (Mouse). Derived from hybridoma N291C/22.DepositorInsertanti-TRIP8b (exon 1a/5) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 40a
Plasmid#87894Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 5a, 17, 40a
Plasmid#87895Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 5a, 17, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1a, 40a
Plasmid#87901Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1a, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1a, 17, 40a
Plasmid#87899Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1a, 17, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 17, 40a
Plasmid#87891Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 17, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 WT minigene
Plasmid#169273PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 WT minigeneDepositorAvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 GT>A minigene
Plasmid#169274PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 GT>A minigeneDepositorInsertRBM28 Exon1-6 GT>A minigene (RBM28 Human)
ExpressionMammalianMutationNM_018077.2:c.(541+1_541+2delinsA)PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Med24-exon minimal CMV pCDNA5
Plasmid#212060PurposeLR vector for integration of Med24-exon into N2a FRT rtTA3 expression cellsDepositorInsertMed24-exon (Med24 Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Med24+exon minimal CMV pCDNA5
Plasmid#212061PurposeLR vector for integration of Med24+exon(57nt) into N2a FRT rtTA3 expression cellsDepositorInsertMed24+exon(57nt) (Med24 Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Zmynd8+exon minimal CMV pCDNA5
Plasmid#212079PurposeLR vector for integration of Zmynd8+exon(48nt) into N2a FRT rtTA3 expression cellsDepositorInsertZmynd8+exon(48nt) (Zmynd8 Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Kdm1a-exon minimal CMV pCDNA5
Plasmid#212054PurposeLR vector for integration of Kdm1a-exon into N2a FRT rtTA3 expression cellsDepositorInsertKdm1a-exon (Kdm1a Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-Phi29(+exo) (LM2759)
Plasmid#208964PurposeUnfused Phi29 DNA polymerase (+exo), expressed from CMV or T7 promoters.DepositorInsertPhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianPromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Chtop-exon minimal CMV pCDNA5
Plasmid#212080PurposeLR vector for integration of Chtop-exon into N2a FRT rtTA3 expression cellsDepositorInsertChtop-exon (Chtop Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
tau exon 9–12 FTDP-17 N279K splicing minigene
Plasmid#122967Purposeexpresses circular tau RNAs with the FTDP-17 N279KDepositorInsertmaps
ExpressionMammalianMutationFTDP-17 mutationAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAct1-LexA-VP16-VAMP2 + LexO-YFP
Plasmid#240975PurposeExpresses membrane-anchored transcription factor (LexA-VP16) in yeast, along with YFP reporter under LexO promoterDepositorInsertLexA-VP16-VAMP2, LexO::YFP
ExpressionYeastAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSK163 CMV-TO-SMN2 Nluc - active (exon 6, 7, 8)
Plasmid#247276PurposeExpresses human SMN2 exons 6, 7, 8 followed by NlucDepositorInsertSMN2 exons 6,7,8-Nluc (SMN2 Human)
ExpressionMammalianMutation"A" insertion at position 49 of exon 7PromoterCMV-TOAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only