We narrowed to 79,257 results for: Rest
-
Plasmid#45270DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA5-EGFP-NLS-T2A-mCherry-PTS1
Plasmid#87827PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using T2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pODN-H2BC11-mR2
Plasmid#183866PurposeRepair template for the C-terminal tagging of H2B histones with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertH2BC11 homology arms with linker-mRuby2 (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mRuby2ExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-MYH10
Plasmid#183869PurposeRepair template for the N-terminal tagging of myosin heavy chain 10 with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertMYH10 homology arms with mRuby2-linker (MYH10 Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
LoxP2-Mb2Tomato-2A (SO240)
Plasmid#99614PurposeTo clone gene of interest downstream of LoxP2-Mb2Tomato-2A cassetteDepositorInsertMb2Tomato
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_FNDC3B
Plasmid#45269DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)-mNeonGreen
Plasmid#205021PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorT-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO GFP MPS1 K-R
Plasmid#59819PurposeAllows the integration of GFP MPS1 K-R in the genome and Tet-inducible expression.DepositorInsertMps1 (TTK Human)
TagsEmGFPExpressionMammalianMutationKD, catalytically inactive, D664APromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_GPR160
Plasmid#45274DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-GFP_activity_reporter
Plasmid#87156PurposeThis lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted).DepositorInsertGFP and sgRNA targeting GFP (NGA restricted)
UseLentiviralAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCAS-sgATG7
Plasmid#75228PurposeAn adaption on the RCAS/tv-a somatic cell gene transfer system, for use in combination with an existing Cas9 background in the cell/mouse of interest. Depositors: Jane Fraser/Noor GammohDepositorAvailable SinceJune 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWzl_neo_DEST_flag_SOX2
Plasmid#45309DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSP1-mp53AS-6xMUT
Plasmid#20904DepositorInsertp53AS (Trp53 Mouse)
ExpressionMammalianMutationpoint mutation (Ser/Thr-Ala) of the 6 N-terminal …Available SinceApril 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDD3248 pCS2-mtagBFP2-p2a-NES-arrb2a-(ENLYFQ/S)x3-SV40NLS-sfCherry3C(1-10)
Plasmid#251770PurposeBlue fluorescent protein-tagged TEVp substrate (three-peat motif) for fluorescent protein reconstitution assayDepositorInsertarrestin, beta 2a (arrb2a Zebrafish)
TagsNLS (SV40), sfCherry3C large fragment and mTagBFP…ExpressionMammalianPromoterCMV IE94Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MeCP2-R168X (pc4734 )
Plasmid#249081PurposeBacteria expression plasmid of MeCP2-R168X (aa1-aa167)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MeCP2-R255X (pc4735)
Plasmid#249082PurposeBacteria expression plasmid of MeCP2-R255X (aa1-aa254)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-GFP-MeCP2 (pc4741 )
Plasmid#249083PurposeBacteria expression plasmid of GFP-MeCP2DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
hTRAK1(S200A, S201A, S719A, S919A)
Plasmid#225225PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A, S719A, S919A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationS200A, S201A, S719A, S919A mutationsPromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only