We narrowed to 12,964 results for: BASE
-
Plasmid#227120PurposeBarcoded assay, UAS sensor for split TEV assays; barcode BC0408DepositorInsert10x clustered UAS element linked to CMV minimal promoter driving barcode 0408 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_10xUAS-CMVmin-BC0441-luc2
Plasmid#227129PurposeBarcoded assay, UAS sensor for split TEV assays; barcode BC0441DepositorInsert10x clustered UAS element linked to CMV minimal promoter driving barcode 0441 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_CRE-CMVmin-BC0498-luc2
Plasmid#227134PurposeBarcoded assay, cAMP/Ca2+ sensor; barcode BC0498DepositorInsert6x clustered CRE element linked to CMV minimal promoter driving barcode 0498 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_10xUAS-CMVmin-BC0440-luc2
Plasmid#227128PurposeBarcoded assay, UAS sensor for split TEV assays; barcode BC0440DepositorInsert10x clustered UAS element linked to CMV minimal promoter driving barcode 0440 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_CRE-CMVmin-BC0504-luc2
Plasmid#227135PurposeBarcoded assay, cAMP/Ca2+ sensor; barcode BC0504DepositorInsert6x clustered CRE element linked to CMV minimal promoter driving barcode 0504 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_10xUAS-CMVmin-BC0442-luc2
Plasmid#227130PurposeBarcoded assay, UAS sensor for split TEV assays; barcode BC0442DepositorInsert10x clustered UAS element linked to CMV minimal promoter driving barcode 0442 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRRH
Plasmid#198540PurposeExpresses human codon-optimized SpCas9-NRRH and blasticidin resistance: EFS promoter-SpCas9-NRRH-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRRH
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH
Plasmid#198542PurposeExpresses human codon-optimized SpCas9-NRCH and blasticidin resistance: EFS promoter-SpCas9-NRCH-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Apr
Plasmid#208000PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE5418_pMBP-GlcR
Plasmid#221192PurposeExpression vector for 10x-MBP-GlcR (MGlcR). GlcR is a glycolate-responsive transcriptional repressor and the gene product of pden4400 from Paracoccus denitrificans, codon optimized for E. coli.DepositorInsertglcR (pden4400 from Paracoccus denitrificans)
Tags10x His tag with E. coli maltose binding protein …ExpressionBacterialPromoterT7 promoter and T7 promoter-lacOAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE5419_p3WJdB-glcO36
Plasmid#221193PurposeGlcR module template with glcO36 operator: T7 promoDNA template of GlcR sensor with glcO36 operator: T7 promoter-glcO36-3WJdB reporter-T7 terminator linear DNA tter-glcO36-3WJdB reporter-T7 terminatorDepositorInsertT7 promoter-glcO36
UseSynthetic BiologyExpressionBacterialPromoterT7 promoter with downstream glcO36 operatorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEndo-I-OnuI-TSM
Plasmid#207954PurposeExpresses a fusion of the homing endonuclease I-OnuI with the thermosensitive L212P VMA1 intein. Endonuclease activity is restricted to lower temperatures.DepositorInsertThermosensitive fusion of I-OnuI and the L212P VMA1 intein.
UseSynthetic BiologyExpressionBacterialMutationLeucine 212 changed to proline, leucine 434 in fu…Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Src(YF)-SsrA(Y7I)-mCer3
Plasmid#220999Purposethis is microTag (Y7I mutation in SsrA)-Src(Y529F) with mCerulean3 at C-terminalDepositorInsertSrc, SsrA, mCerulean3 (Src Mouse)
TagsmCerulean3ExpressionMammalianMutationY529F in Src, Y7I in SsrAPromoterCMVAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pCMV-mScarlet-I-eDHFR-ORP5(ΔPH)
Plasmid#214277PurposeMammalian expression of ORP5(ΔPH) fused to mScarlet-I-tagged E. coli DHFRDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP782_Traptavidin-KRAB-CO
Plasmid#211775PurposeAviTag counterpart binding domain, Traptavidin, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertSpyCatcher-DNMT3A
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceFeb. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K48R/K63R)-yeGFP-His6
Plasmid#212785PurposeC-terminal PCR-based tagging with CUbo(K48R/K63R)-yeGFP-His6 in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-mXRCC1pd-eGFP
Plasmid#206035PurposeMammalian expression of PAR-deficient mXRCC1pd coupled to eGFP under the control of a EF1a promoterDepositorInsertmXRCC1pd
TagseGFPExpressionMammalianMutationS105A, S186A, K188A, S195A, S221A, S222A,S238A, S…PromoterEf1aAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-hXRCC1pd-HIS
Plasmid#206036PurposeBacterial expression of PAR-deficient hXRCC1pd with 6xHis tag, under the control of T7 promoterDepositorInserthXRCC1
TagsHISExpressionBacterialMutationS103A,R186A,S184A,S193A,S219A,S220A,S236A,S268APromoterT7Available SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP785_Traptavidin-DNMT3A-CO
Plasmid#211778PurposeAviTag counterpart binding domain, Traptavidin, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertTraptavidin-EZH2
Tags3xV5ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect EZH2 e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP781_SnoopCatcher-KRAB-CO
Plasmid#211774PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertTraptavidin-KRAB
Tags3xV5ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL670
Plasmid#196818PurposeLrCas9 cytosine base editing plasmid in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL671
Plasmid#196819PurposeLrCas9 cytosine base editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL672
Plasmid#196820PurposeLrCas9 adenine base editing plasmid V1.0 in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL673
Plasmid#196821PurposeLrCas9 adenine base editing plasmid V2.0 in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGA-red-mini
Plasmid#196338PurposeEasy-MISE toolkit Level 1 destination plasmid for cassette cloning with BsaI-based Golden Gate Assembly; allowing fast postitive clones test with mRFP1 fluorescent protein-based red/white screeningDepositorTypeEmpty backboneUseSynthetic Biology; Golden gate assembly backboneAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGA-red-maxi
Plasmid#196337PurposeEasy-MISE toolkit Level 1 destination plasmid for cassette cloning with BsaI-based Golden Gate Assembly; allowing fast postitive clones test with mRFP1 fluorescent protein-based red/white screeningDepositorTypeEmpty backboneUseSynthetic Biology; Golden gate assembly backboneAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQC.SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA(Q5A)]-Fluc
Plasmid#200127PurposeRetroviral expression of SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA(Q5A)] protease reporter and P2A firefly luciferase in mammalian cellsDepositorInsertFlip-nluc(LgBiT1-8)CP[CoVA(Q5A)] P2A firefly luciferase
UseRetroviralExpressionMammalianPromoterCMVAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQC.SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA(SA)]-Fluc
Plasmid#200128PurposeRetroviral expression of SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA(SA)] protease reporter and P2A firefly luciferase in mammalian cellsDepositorInsertFlip-nluc(LgBiT1-8)CP[CoVA(SA)] P2A firefly luciferase
UseRetroviralExpressionMammalianPromoterCMVAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQC.SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA]-Fluc
Plasmid#200126PurposeRetroviral expression of SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA] protease reporter and P2A firefly luciferase in mammalian cellsDepositorInsertFlip-nluc(LgBiT1-8)CP[CoVA] P2A firefly luciferase
UseRetroviralExpressionMammalianPromoterCMVAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG.Myc-SARS2_3CL(C145A)
Plasmid#200121PurposeExpresses N-terminal Myc-tagged human codon optimyzed SARS-CoV-2 3CL C145A in mammalian cellsDepositorInsertSARS-CoV-2 3CL protease (ORF1ab SARS-CoV-2)
TagsMycExpressionMammalianMutationC145APromoterCAGAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP70_pU.CAG.Cas9-D10A-K848A-R1060A.rBGpA
Plasmid#199254PurposeExpression construct encoding the high specificity SpCas9-KARA-D10A nickaseDepositorInsertHigh specificity S. pyogenes Cas9-D10A-KARA nickase
UseCRISPRTags3XFLAG epitope, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianMutationD10A K848A R1060APromoterCAG promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP76_pU.CAG.Cas9-D10A-K848A.rBGpA
Plasmid#199253PurposeExpression construct encoding the high specificity SpCas9-KA-D10A nickaseDepositorInsertHigh specificity S. pyogenes Cas9-D10A-KA nickase
UseCRISPRTags3XFLAG epitope, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianMutationD10A K848APromoterCAG promoterAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPT-mEGFP
Plasmid#190606PurposeObtained by creating a deletion inside the mCherry coding sequence in pWPT-/GCCACC-mEGFP-IRES-mCherry (Addgene #49235)DepositorInsertsmEGFP
mCherry
UseLentiviralMutationa deletion was created in mCherry CDS impairing i…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15541_dCBE-SuperFi-Cas9
Plasmid#184371PurposeMammalian expression of nuclease inactive SuperFi-Cas9 CBE base editorDepositorInsertdCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15543_dABE-SuperFi-Cas9
Plasmid#184373PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE7 base editorDepositorInsertdABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only